WormBase Tree Display for Variation: WBVar00144076
expand all nodes | collapse all nodes | view schema
| WBVar00144076 | Evidence | Paper_evidence | WBPaper00000502 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | e1526 | |||||
| Other_name | CE37674:p.Arg1401Cys | ||||||
| CE37672:p.Arg1751Cys | |||||||
| CE48078:p.Arg1804Cys | |||||||
| T07H8.4e.1:c.5251C>T | |||||||
| T07H8.4d.1:c.5374C>T | |||||||
| T07H8.4f.1:c.4843C>T | |||||||
| T07H8.4a.1:c.5410C>T | |||||||
| CE37673:p.Arg1615Cys | |||||||
| CE48065:p.Arg1803Cys | |||||||
| T07H8.4g.1:c.4201C>T | |||||||
| CE47967:p.Arg1792Cys | |||||||
| T07H8.4h.1:c.5407C>T | |||||||
| T07H8.4d.2:c.5374C>T | |||||||
| HGVSg | CHROMOSOME_V:g.6965589C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | T07H8 | |||
| Flanking_sequences | ggaacagatccgtgtatggaatctttggat | gtggaagttggtgtgaggcaatgtcaaata | |||||
| Mapping_target | T07H8 | ||||||
| Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00024622 | ||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | CB | ||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003165 | |||||
| Transcript | T07H8.4e.1 (12) | ||||||
| T07H8.4g.1 (12) | |||||||
| T07H8.4f.1 (12) | |||||||
| T07H8.4d.1 (12) | |||||||
| T07H8.4a.1 (12) | |||||||
| T07H8.4h.1 | VEP_consequence | missense_variant | |||||
| VEP_impact | MODERATE | ||||||
| SIFT | 0 | deleterious | |||||
| PolyPhen | 1 | probably_damaging | |||||
| HGVSc | T07H8.4h.1:c.5407C>T | ||||||
| HGVSp | CE48065:p.Arg1803Cys | ||||||
| cDNA_position | 5407 | ||||||
| CDS_position | 5407 | ||||||
| Protein_position | 1803 | ||||||
| Exon_number | 27/30 | ||||||
| Codon_change | Cgt/Tgt | ||||||
| Amino_acid_change | R/C | ||||||
| T07H8.4d.2 (12) | |||||||
| Genetics | Interpolated_map_position | V | 0.483134 | ||||
| Description | Phenotype | WBPhenotype:0000456 | Paper_evidence | WBPaper00000502 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Recessive | Paper_evidence | WBPaper00000502 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001310 | Paper_evidence | WBPaper00000502 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Cell bodies of anterior touch neurons displaced dorsally. | Paper_evidence | WBPaper00000502 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Recessive | Paper_evidence | WBPaper00000502 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001398 | Paper_evidence | WBPaper00038449 | |||||
| Curator_confirmed | WBPerson3779 | ||||||
| WBPhenotype:0001534 | Paper_evidence | WBPaper00000502 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | ECM is missing along the VC. | Paper_evidence | WBPaper00000502 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0001676 | Paper_evidence | WBPaper00038449 | |||||
| Curator_confirmed | WBPerson3779 | ||||||
| Phenotype_not_observed | WBPhenotype:0000054 | Paper_evidence | WBPaper00038449 | ||||
| Curator_confirmed | WBPerson3779 | ||||||
| Reference | WBPaper00038449 | ||||||
| WBPaper00000502 | |||||||
| Method | Substitution_allele |
