WormBase Tree Display for Variation: WBVar00239177
expand all nodes | collapse all nodes | view schema
WBVar00239177 | Name | Public_name | pk35 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | pk35te | ||||||||
E02C12.5a.1:c.118+272_961del | |||||||||
HGVSg | CHROMOSOME_V:g.9357839_9359361del | ||||||||
Sequence_details | SMap | S_parent | Sequence | E02C12 | |||||
Flanking_sequences | ccttctgttctcgaacactttttcaaaaaa | tgcatcagacgtgtgcaacagatacagatc | |||||||
Mapping_target | E02C12 | ||||||||
Type_of_mutation | Insertion | ||||||||
Deletion | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Transposon_insertion | Tc1 | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00007863 | ||||||||
WBStrain00028900 | |||||||||
WBStrain00028902 | |||||||||
WBStrain00028996 | |||||||||
Laboratory | NL | ||||||||
Author | Zwaal RR | ||||||||
Plasterk RHA | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001665 | |||||||
Transcript | E02C12.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | E02C12.5a.1:c.118+272_961del | ||||||||
cDNA_position | ?-985 | ||||||||
CDS_position | ?-961 | ||||||||
Protein_position | ?-321 | ||||||||
Intron_number | 2-6/8 | ||||||||
Exon_number | 3-7/9 | ||||||||
Interactor | WBInteraction000501261 | ||||||||
WBInteraction000501273 | |||||||||
WBInteraction000521352 | |||||||||
WBInteraction000523953 | |||||||||
Isolation | Mutagen | Tc1 | |||||||
Reverse_genetics | Derived from Tc1 insertion allele pk12 | ||||||||
Derived_from_variation | WBVar00239154 | ||||||||
Genetics | Interpolated_map_position | V | 2.01507 | ||||||
Description | Phenotype (21) | ||||||||
Phenotype_not_observed | WBPhenotype:0000061 | Paper_evidence | WBPaper00033456 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Life span is unaffected in gpa-3(pk35) mutants | Paper_evidence | WBPaper00033456 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033456 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000114 | Paper_evidence | WBPaper00033456 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | sod-3 mRNA level in gpa-3(pk35) remained unchanged relative to N2 wild type. No change in mRNA levels of PDE-1 and PDE-5 in gpa-3(pk35) mutants | Paper_evidence | WBPaper00033456 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033456 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00048972 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "Since the animals harboring the dominant active version of GPA-3 showed a slight decrease in fluorescence intensity of GFP::RAB-5, we wondered whether the opposite happens in the gpa-3(pk35) loss-of-function mutant. However, gpa-3(pk35) animals showed wild type fluorescence intensity levels (Fig 6A and 6D and 6E)." | Paper_evidence | WBPaper00048972 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Phenotype_assay | Genotype | GFP::RAB-5 | Paper_evidence | WBPaper00048972 | |||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001414 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
WBPhenotype:0001700 | Paper_evidence | WBPaper00051284 | |||||||
Curator_confirmed | WBPerson37651 | ||||||||
Remark | Figure 6C | Paper_evidence | WBPaper00051284 | ||||||
Curator_confirmed | WBPerson37651 | ||||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00051284 | |||||
Curator_confirmed | WBPerson37651 | ||||||||
WBPhenotype:0001765 | Paper_evidence | WBPaper00031936 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Animals with mutations in individual G protein subunits respond normally to CO2 | Paper_evidence | WBPaper00031936 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00031936 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 10% CO2 | Paper_evidence | WBPaper00031936 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001818 | Paper_evidence | WBPaper00035254 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Calcium dynamics in adult ASK neurons in response to C3 and C6 were unaffected in gpa-3 mutant animals | Paper_evidence | WBPaper00035254 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00035254 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0002055 | Paper_evidence | WBPaper00036207 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Photocurrents appeared to be normal. | Paper_evidence | WBPaper00036207 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002212 | Paper_evidence | WBPaper00003465 | |||||||
Curator_confirmed | WBPerson291 | ||||||||
Reference | WBPaper00001784 | ||||||||
WBPaper00043908 | |||||||||
WBPaper00031936 | |||||||||
WBPaper00033456 | |||||||||
WBPaper00003465 | |||||||||
WBPaper00036207 | |||||||||
WBPaper00035254 | |||||||||
WBPaper00048972 | |||||||||
WBPaper00051284 | |||||||||
Remark | Insertion is a tc1 element | ||||||||
Method | Transposon_insertion |