WormBase Tree Display for Variation: WBVar00143415
expand all nodes | collapse all nodes | view schema
WBVar00143415 | Evidence | Paper_evidence | WBPaper00003865 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e699 | |||||||
Other_name | CE25060:p.Thr63Ile | ||||||||
M03A1.1.1:c.188C>T | |||||||||
HGVSg | CHROMOSOME_II:g.4578134C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | M03A1 | |||||
Flanking_sequences | atatgatcaattttcagtggatggaagaaa | ttggcgaaatccagcggcgacagacgagaa | |||||||
Mapping_target | M03A1 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00003865 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00005349 | ||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00006868 | |||||||
WBGene00305535 | |||||||||
Transcript | M03A1.1.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 0.993 | probably_damaging | |||||||
HGVSc | M03A1.1.1:c.188C>T | ||||||||
HGVSp | CE25060:p.Thr63Ile | ||||||||
cDNA_position | 277 | ||||||||
CDS_position | 188 | ||||||||
Protein_position | 63 | ||||||||
Exon_number | 4/12 | ||||||||
Codon_change | aCt/aTt | ||||||||
Amino_acid_change | T/I | ||||||||
M03A1.13 | |||||||||
Interactor (48) | |||||||||
Genetics | Interpolated_map_position | II | -3.86415 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibited ~10% embryonic lethality (N=2222). | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000054 | Paper_evidence | WBPaper00031951 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | N=2222 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000023 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000195 | Paper_evidence | WBPaper00031951 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals showed weak defects in DTC migration along the ventral body wall muscle between the hyp7 hypodermal syncytium (phase 1) and more defects during the migration along the dorsal body wall muscle (phase 3), but not while crossing hyp7 (phase 2), as visualized by lag-2::GFP expression. | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006865 | PATO:0000460 | Paper_evidence | WBPaper00031951 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Life_stage (3) | |||||||||
GO_term | GO:0016477 | PATO:0000460 | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were reared on NA22 bacteria instead of OP50. | Paper_evidence | WBPaper00031951 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Temperature | 20 | Paper_evidence | WBPaper00031951 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0002045 | Paper_evidence | WBPaper00040629 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Mutants show decreased germ-cell corpse numbers. | Paper_evidence | WBPaper00040629 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00040629 | ||||||||
WBPaper00031951 | |||||||||
Method | Substitution_allele |