WormBase Tree Display for Variation: WBVar00241517
expand all nodes | collapse all nodes | view schema
WBVar00241517 | Evidence | Paper_evidence | WBPaper00035146 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | rh46 | ||||||
Other_name | F41C6.1.1:c.469G>C | |||||||
F41C6.1.2:c.469G>C | ||||||||
CE04538:p.Ala157Pro | ||||||||
HGVSg | CHROMOSOME_X:g.6890708G>C | |||||||
Sequence_details | SMap | S_parent | Sequence | F41C6 | ||||
Flanking_sequences | gcacttctgttcccgtctcccagattcaatg | cactttacaagtctgctgactttggaaagac | ||||||
Mapping_target | F41C6 | |||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00035146 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (21) | ||||||||
Laboratory | NJ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00006746 | ||||||
Transcript | F41C6.1.1 (12) | |||||||
F41C6.1.2 (12) | ||||||||
Interactor | WBInteraction000500102 | |||||||
WBInteraction000500103 | ||||||||
WBInteraction000500104 | ||||||||
WBInteraction000500105 | ||||||||
WBInteraction000500107 | ||||||||
WBInteraction000500170 | ||||||||
WBInteraction000500171 | ||||||||
WBInteraction000500172 | ||||||||
WBInteraction000500173 | ||||||||
WBInteraction000500174 | ||||||||
WBInteraction000500175 | ||||||||
WBInteraction000500178 | ||||||||
WBInteraction000500180 | ||||||||
WBInteraction000500181 | ||||||||
WBInteraction000500182 | ||||||||
WBInteraction000500184 | ||||||||
WBInteraction000500185 | ||||||||
WBInteraction000500186 | ||||||||
WBInteraction000500187 | ||||||||
WBInteraction000500188 | ||||||||
WBInteraction000500191 | ||||||||
WBInteraction000500926 | ||||||||
WBInteraction000500927 | ||||||||
WBInteraction000500930 | ||||||||
WBInteraction000500931 | ||||||||
WBInteraction000500932 | ||||||||
WBInteraction000500934 | ||||||||
WBInteraction000500935 | ||||||||
WBInteraction000504804 | ||||||||
WBInteraction000517247 | ||||||||
WBInteraction000517248 | ||||||||
Genetics | Interpolated_map_position | X | -2.09889 | |||||
Description | Phenotype | WBPhenotype:0000104 | Paper_evidence | WBPaper00035146 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | UNC-40::GFP is not asymmetrically localized like WT but is more equally distributed across the HSN surface. | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000384 | Paper_evidence | WBPaper00035146 | ||||||
WBPaper00031828 | ||||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | AVM axons migrate anteriorly and HSN axons migrate in a number of aberrant patterns. These defects are more pronounced at 20 deg C versus 15 deg C. | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson712 | |||||||
Animals exhibit dorsal guidance defects. | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Loss of unc-6 function results in 40% failure of ALM ventral outgrowth. | Paper_evidence | WBPaper00031828 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations | Anatomy_term (4) | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000541 | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | In unc-6 mutants, 80% of the DA and DB motor axons fail to reach the dorsal cord at 20C. | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | |||||||
EQ_annotations | Anatomy_term (2) | |||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000679 | Paper_evidence | WBPaper00035146 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | UNC-40::GFP is globally localized unlike in wild type animals, and in HSN is evenly distributed along the surface rather than asymmetrically localized. | Paper_evidence | WBPaper00035146 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00019344 | |||||||
WBPaper00031828 | ||||||||
WBPaper00035146 | ||||||||
WBPaper00010791 | ||||||||
WBPaper00026240 | ||||||||
WBPaper00025961 | ||||||||
Method | Substitution_allele |