WormBase Tree Display for Variation: WBVar00143617
expand all nodes | collapse all nodes | view schema
| WBVar00143617 | Name | Public_name | e937 | ||
|---|---|---|---|---|---|
| Other_name | K04F10.4d.2:c.1971+275_1971+3600del | ||||
| K04F10.4h.1:c.1971+275_*310del | |||||
| K04F10.4i.1:c.1971+275_1972-438del | |||||
| K04F10.4d.1:c.1971+275_1971+3600del | |||||
| K04F10.4b.1:c.1971+275_1971+3600del | |||||
| K04F10.4j.1:c.1971+275_1972-752del | |||||
| K04F10.4c.1:c.1971+275_1971+3600del | |||||
| HGVSg | CHROMOSOME_I:g.6345831_6349156del | ||||
| Sequence_details | SMap | S_parent | Sequence | K04F10 | |
| Flanking_sequences | aaattgaaaaattgaaaaaatcaacaaaat | taatttccctgaatggaatttcaaccaaat | |||
| Mapping_target | K04F10 | ||||
| Type_of_mutation | Deletion | ||||
| SeqStatus | Sequenced | ||||
| Variation_type | Allele | ||||
| Origin | Species | Caenorhabditis elegans | |||
| Strain (502) | |||||
| Laboratory | CB | ||||
| CA | |||||
| UP | |||||
| Status | Live | ||||
| Affects | Gene | WBGene00200715 | |||
| WBGene00000254 | |||||
| Transcript (12) | |||||
| Interactor | WBInteraction000537297 | ||||
| Genetics | Interpolated_map_position | I | 1.02091 | ||
| Mapping_data | In_2_point | 260 | |||
| 261 | |||||
| 262 | |||||
| 5220 | |||||
| 6170 | |||||
| 6188 | |||||
| 6193 | |||||
| 6200 | |||||
| In_multi_point (15) | |||||
| In_pos_neg_data | 509 | ||||
| 4020 | |||||
| 4026 | |||||
| 4035 | |||||
| 4040 | |||||
| 4047 | |||||
| 4054 | |||||
| 4061 | |||||
| 4065 | |||||
| 5317 | |||||
| 5360 | |||||
| 6196 | |||||
| 6313 | |||||
| 6357 | |||||
| 6373 | |||||
| 6403 | |||||
| 6432 | |||||
| 6450 | |||||
| 6465 | |||||
| 6471 | |||||
| 6478 | |||||
| 6485 | |||||
| 6490 | |||||
| 6497 | |||||
| 6505 | |||||
| 6521 | |||||
| 6527 | |||||
| 6536 | |||||
| 6550 | |||||
| 6562 | |||||
| 6594 | |||||
| 6601 | |||||
| 6606 | |||||
| 6612 | |||||
| 6624 | |||||
| 6642 | |||||
| 6658 | |||||
| Marked_rearrangement | hT2[bli-4(e937) let-?(h661)] | ||||
| hT2[bli-4(e937) let-?(q782) qIs48] | |||||
| hT2[bli-4(e937) qIs48] | |||||
| hT2[bli-4(e937) unc-29(h1011)] | |||||
| hT2[bli-4(e937)] | |||||
| Description (2) | |||||
| Reference (30) | |||||
| Remark | e937 is a 3325bp deletion | Paper_evidence | WBPaper00028453 | ||
| Allele sequenced by Andrew Chisholm | |||||
| Variation stub/paper connection generated from the May 2021 NN VFP dataset. | |||||
| Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
| Method | Deletion_allele |
