WormBase Tree Display for Variation: WBVar00143020
expand all nodes | collapse all nodes | view schema
WBVar00143020 | Evidence | Paper_evidence | WBPaper00001835 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | e187 | |||||||
Other_name | CE03591:p.Arg71His | ||||||||
T01B7.7.1:c.212G>A | |||||||||
HGVSg | CHROMOSOME_II:g.8733312G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | T01B7 | |||||
Flanking_sequences | ggagcaggaaccgcttccaaccgtgtgagac | tcaacaatatggaggatatggagccactgg | |||||||
Mapping_target | T01B7 | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00001835 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain (18) | |||||||||
Laboratory | CB | ||||||||
Status | Live | ||||||||
Linked_to | WBVar00143021 | ||||||||
Affects | Gene | WBGene00004397 | |||||||
Transcript | T01B7.7.1 (12) | ||||||||
Interactor (19) | |||||||||
Genetics | Interpolated_map_position | II | 0.87118 | ||||||
Mapping_data | In_2_point (5) | ||||||||
In_multi_point (12) | |||||||||
In_pos_neg_data | 635 | ||||||||
1168 | |||||||||
1171 | |||||||||
1174 | |||||||||
1177 | |||||||||
1180 | |||||||||
1183 | |||||||||
1187 | |||||||||
1191 | |||||||||
1195 | |||||||||
1199 | |||||||||
1203 | |||||||||
1266 | |||||||||
1294 | |||||||||
1302 | |||||||||
1311 | |||||||||
1367 | |||||||||
1541 | |||||||||
1641 | |||||||||
2456 | |||||||||
Description | Phenotype | WBPhenotype:0000502 | Paper_evidence | WBPaper00000465 | |||||
WBPaper00000906 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Strong roller L3 through adult. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
adults, L3 and L4 larvae right-handed rollers. Similar phenotype in e187/Df. | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
WBPaper00000906 | |||||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000035 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000038 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
WBls:0000032 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00033444 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001516 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Alae make 1 whole turn along the length of the animal. | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0000583 | Paper_evidence | WBPaper00000465 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 16C, 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001412 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001515 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001517 | Paper_evidence | WBPaper00000465 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00000465 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Temperature | 25C | Paper_evidence | WBPaper00000465 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Reference (13) | |||||||||
Method | Substitution_allele |