WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e188 | ||||||
Other_name | e188ts | |||||||
H27M09.4.1:c.415G>C | ||||||||
CE25036:p.Gly139Arg | ||||||||
HGVSg | CHROMOSOME_I:g.6844486G>C | |||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | ||||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | ||||||
Mapping_target | H27M09 | |||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (62) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects (3) | ||||||||
Genetics | Interpolated_map_position | I | 1.37773 | |||||
Mapping_data | In_2_point | 5 | ||||||
241 | ||||||||
242 | ||||||||
5116 | ||||||||
5118 | ||||||||
6055 | ||||||||
In_multi_point | 12 | |||||||
231 | ||||||||
236 | ||||||||
237 | ||||||||
241 | ||||||||
242 | ||||||||
243 | ||||||||
244 | ||||||||
248 | ||||||||
250 | ||||||||
251 | ||||||||
279 | ||||||||
283 | ||||||||
290 | ||||||||
345 | ||||||||
346 | ||||||||
431 | ||||||||
432 | ||||||||
433 | ||||||||
435 | ||||||||
438 | ||||||||
439 | ||||||||
443 | ||||||||
446 | ||||||||
447 | ||||||||
449 | ||||||||
450 | ||||||||
710 | ||||||||
814 | ||||||||
1223 | ||||||||
1232 | ||||||||
1235 | ||||||||
1274 | ||||||||
1460 | ||||||||
1461 | ||||||||
1462 | ||||||||
1463 | ||||||||
1464 | ||||||||
1465 | ||||||||
1466 | ||||||||
1694 | ||||||||
1784 | ||||||||
1889 | ||||||||
1890 | ||||||||
1892 | ||||||||
2000 | ||||||||
2089 | ||||||||
2140 | ||||||||
2141 | ||||||||
2142 | ||||||||
2143 | ||||||||
2144 | ||||||||
2145 | ||||||||
2146 | ||||||||
2147 | ||||||||
2148 | ||||||||
2149 | ||||||||
2150 | ||||||||
2281 | ||||||||
2282 | ||||||||
2459 | ||||||||
2468 | ||||||||
3004 | ||||||||
3005 | ||||||||
3196 | ||||||||
3513 | ||||||||
In_pos_neg_data (55) | ||||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ts lethal (25C). Lethality enhanced by Smg. ES3 (all stages 20C). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Medium dumpy adult, strong dumpy L1 (20C). Easy to score (ES3) at all stages (20C). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00001328 | |||||||
WBPaper00000031 | ||||||||
WBPaper00004883 | ||||||||
WBPaper00024024 | ||||||||
WBPaper00014397 | ||||||||
WBPaper00016102 | ||||||||
WBPaper00025792 | ||||||||
WBPaper00033444 | ||||||||
WBPaper00061175 | ||||||||
Remark (2) | ||||||||
Method | Substitution_allele |