WormBase Tree Display for Variation: WBVar00142935
expand all nodes | collapse all nodes | view schema
WBVar00142935 | Name | Public_name | e51 | ||||
---|---|---|---|---|---|---|---|
Other_name (18) | |||||||
HGVSg | CHROMOSOME_I:g.7434408C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C44E1 | |||
Flanking_sequences | AAGATGACACTCACCAATATGATGAAGTTGATCGTGGATCC | GAGTATCTTTCACAAGAACACCATCAGTAGATAGAACAG | |||||
Mapping_target | C44E1 | ||||||
Type_of_mutation | Substitution | C | T | Person_evidence | WBPerson26471 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Engineered_allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (64) | |||||||
Laboratory (3) | |||||||
Person | WBPerson26471 | ||||||
Status | Live | ||||||
Linked_to | WBVar02146566 | ||||||
Affects | Gene | WBGene00006752 | |||||
Transcript | ZK524.2e.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2e.1:c.1411C>T | ||||||
HGVSp | CE34626:p.Arg471Ter | ||||||
cDNA_position | 1411 | ||||||
CDS_position | 1411 | ||||||
Protein_position | 471 | ||||||
Exon_number | 11/30 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2c.1:c.388C>T | ||||||
HGVSp | CE34624:p.Arg130Ter | ||||||
cDNA_position | 388 | ||||||
CDS_position | 388 | ||||||
Protein_position | 130 | ||||||
Exon_number | 3/22 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2f.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2f.1:c.1420C>T | ||||||
HGVSp | CE43866:p.Arg474Ter | ||||||
cDNA_position | 1420 | ||||||
CDS_position | 1420 | ||||||
Protein_position | 474 | ||||||
Exon_number | 11/30 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2j.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2j.1:c.1375C>T | ||||||
HGVSp | CE51718:p.Arg459Ter | ||||||
cDNA_position | 1375 | ||||||
CDS_position | 1375 | ||||||
Protein_position | 459 | ||||||
Exon_number | 11/29 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2k.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2k.1:c.1366C>T | ||||||
HGVSp | CE51726:p.Arg456Ter | ||||||
cDNA_position | 1366 | ||||||
CDS_position | 1366 | ||||||
Protein_position | 456 | ||||||
Exon_number | 11/29 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2a.1:c.1411C>T | ||||||
HGVSp | CE15371:p.Arg471Ter | ||||||
cDNA_position | 1411 | ||||||
CDS_position | 1411 | ||||||
Protein_position | 471 | ||||||
Exon_number | 11/30 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2i.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2i.1:c.1420C>T | ||||||
HGVSp | CE32552:p.Arg474Ter | ||||||
cDNA_position | 1420 | ||||||
CDS_position | 1420 | ||||||
Protein_position | 474 | ||||||
Exon_number | 11/29 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2d.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2d.1:c.1411C>T | ||||||
HGVSp | CE34625:p.Arg471Ter | ||||||
cDNA_position | 1411 | ||||||
CDS_position | 1411 | ||||||
Protein_position | 471 | ||||||
Exon_number | 11/31 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
ZK524.2h.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | ZK524.2h.1:c.388C>T | ||||||
HGVSp | CE51759:p.Arg130Ter | ||||||
cDNA_position | 388 | ||||||
CDS_position | 388 | ||||||
Protein_position | 130 | ||||||
Exon_number | 3/21 | ||||||
Codon_change | Cga/Tga | ||||||
Amino_acid_change | R/* | ||||||
Interactor | WBInteraction000518950 | ||||||
Isolation | Mutagen | EMS | |||||
Genetics | Interpolated_map_position | I | 2.07389 | ||||
Mapping_data | In_2_point (20) | ||||||
In_multi_point | 4 | ||||||
30 | |||||||
35 | |||||||
36 | |||||||
204 | |||||||
205 | |||||||
242 | |||||||
245 | |||||||
279 | |||||||
312 | |||||||
343 | |||||||
345 | |||||||
360 | |||||||
365 | |||||||
373 | |||||||
420 | |||||||
431 | |||||||
432 | |||||||
433 | |||||||
435 | |||||||
438 | |||||||
439 | |||||||
443 | |||||||
446 | |||||||
447 | |||||||
449 | |||||||
450 | |||||||
452 | |||||||
499 | |||||||
505 | |||||||
510 | |||||||
511 | |||||||
512 | |||||||
515 | |||||||
517 | |||||||
518 | |||||||
566 | |||||||
572 | |||||||
573 | |||||||
576 | |||||||
719 | |||||||
720 | |||||||
814 | |||||||
958 | |||||||
963 | |||||||
976 | |||||||
977 | |||||||
986 | |||||||
1064 | |||||||
1223 | |||||||
1274 | |||||||
1370 | |||||||
1377 | |||||||
1446 | |||||||
1450 | |||||||
1460 | |||||||
1481 | |||||||
1689 | |||||||
1745 | |||||||
1747 | |||||||
1782 | |||||||
1784 | |||||||
1890 | |||||||
1902 | |||||||
2000 | |||||||
2001 | |||||||
2041 | |||||||
2042 | |||||||
2089 | |||||||
2278 | |||||||
2279 | |||||||
2280 | |||||||
2410 | |||||||
2426 | |||||||
2456 | |||||||
3000 | |||||||
3001 | |||||||
3002 | |||||||
3003 | |||||||
3035 | |||||||
3038 | |||||||
3039 | |||||||
3042 | |||||||
3045 | |||||||
3233 | |||||||
3514 | |||||||
5458 | |||||||
In_pos_neg_data | 466 | ||||||
470 | |||||||
2514 | |||||||
5851 | |||||||
5853 | |||||||
5963 | |||||||
8066 | |||||||
8086 | |||||||
Description | Phenotype (13) | ||||||
Phenotype_not_observed (4) | |||||||
Reference (29) | |||||||
Remark | Old Mapping_target ZK524 updated based on the VEP analysis pipeline to C44E1. | ||||||
Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006752 Opal_UGA R to STOP | Person_evidence | WBPerson26471" | |||||
WBPerson26471 | |||||||
Method | Substitution_allele |