WormBase Tree Display for Variation: WBVar00143063
expand all nodes | collapse all nodes | view schema
WBVar00143063 | Evidence | Paper_evidence | WBPaper00031175 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | e251 | |||||
Other_name | CE24860:p.Trp452Ter | ||||||
C50C3.9c.1:c.1355G>A | |||||||
CE32168:p.Trp496Ter | |||||||
C50C3.9a.1:c.1487G>A | |||||||
HGVSg | CHROMOSOME_III:g.8197512C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | C50C3 | |||
Flanking_sequences | cattataaagaatctggacaattatcttggt | gactggagtttacagagaaagattggtgagt | |||||
Mapping_target | C50C3 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00031175 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain (67) | |||||||
Laboratory | CB | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00006772 | |||||
Transcript | C50C3.9a.1 | VEP_consequence | stop_gained | ||||
VEP_impact | HIGH | ||||||
HGVSc | C50C3.9a.1:c.1487G>A | ||||||
HGVSp | CE32168:p.Trp496Ter | ||||||
cDNA_position | 1588 | ||||||
CDS_position | 1487 | ||||||
Protein_position | 496 | ||||||
Exon_number | 9/18 | ||||||
Codon_change | tGg/tAg | ||||||
Amino_acid_change | W/* | ||||||
C50C3.9c.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | ||||||
HGVSc | C50C3.9c.1:c.1355G>A | ||||||
HGVSp | CE24860:p.Trp452Ter | ||||||
cDNA_position | 1467 | ||||||
CDS_position | 1355 | ||||||
Protein_position | 452 | ||||||
Exon_number | 8/17 | ||||||
Codon_change | tGg/tAg | ||||||
Amino_acid_change | W/* | ||||||
Interactor | WBInteraction000052098 | ||||||
WBInteraction000052102 | |||||||
WBInteraction000502423 | |||||||
WBInteraction000502424 | |||||||
Genetics | Interpolated_map_position | III | -0.373497 | ||||
Mapping_data | In_2_point | 52 | |||||
70 | |||||||
482 | |||||||
485 | |||||||
486 | |||||||
487 | |||||||
3796 | |||||||
3797 | |||||||
4694 | |||||||
4696 | |||||||
6053 | |||||||
6072 | |||||||
In_multi_point (86) | |||||||
In_pos_neg_data (4) | |||||||
Description | Phenotype (20) | ||||||
Phenotype_not_observed (5) | |||||||
Reference (30) | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006772 Amber_UAG_or_Opal_UGA | ||||||
Method | Substitution_allele |