WormBase Tree Display for Variation: WBVar00143044
expand all nodes | collapse all nodes | view schema
WBVar00143044 | Evidence | Paper_evidence | WBPaper00006063 | ||
---|---|---|---|---|---|
WBPaper00005177 | |||||
Name | Public_name | e224 | |||
Other_name | F46E10.9.1:c.227G>A | ||||
F46E10.9.2:c.227G>A | |||||
CE20819:p.Gly76Glu | |||||
HGVSg | CHROMOSOME_V:g.6512793C>T | ||||
Sequence_details | SMap | S_parent | Sequence | F46E10 | |
Flanking_sequences | actggtctgatgatcttggaatcaaggttg | agaagtcgatgttaccgtcaatccaggact | |||
Mapping_target | F46E10 | ||||
Type_of_mutation | Substitution | g | a | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain (130) | |||||
Laboratory | CB | ||||
Status | Live | ||||
Affects | Gene | WBGene00001073 | |||
Transcript | F46E10.9.2 (12) | ||||
F46E10.9.1 (12) | |||||
Interactor (14) | |||||
Genetics | Interpolated_map_position | V | -0.00724445 | ||
Mapping_data | In_2_point | 123 | |||
124 | |||||
125 | |||||
126 | |||||
127 | |||||
128 | |||||
129 | |||||
130 | |||||
131 | |||||
133 | |||||
134 | |||||
135 | |||||
136 | |||||
137 | |||||
140 | |||||
141 | |||||
230 | |||||
233 | |||||
235 | |||||
252 | |||||
253 | |||||
304 | |||||
308 | |||||
309 | |||||
310 | |||||
311 | |||||
312 | |||||
313 | |||||
315 | |||||
319 | |||||
371 | |||||
431 | |||||
585 | |||||
634 | |||||
790 | |||||
791 | |||||
792 | |||||
839 | |||||
841 | |||||
1724 | |||||
2841 | |||||
2844 | |||||
2873 | |||||
2905 | |||||
2958 | |||||
2962 | |||||
2967 | |||||
2972 | |||||
2976 | |||||
2982 | |||||
2992 | |||||
3017 | |||||
3023 | |||||
3131 | |||||
3136 | |||||
3382 | |||||
3383 | |||||
3387 | |||||
3391 | |||||
3472 | |||||
3473 | |||||
3483 | |||||
3490 | |||||
3495 | |||||
3496 | |||||
3502 | |||||
3508 | |||||
3564 | |||||
3565 | |||||
3571 | |||||
3633 | |||||
3707 | |||||
3911 | |||||
4436 | |||||
4441 | |||||
4448 | |||||
4449 | |||||
4581 | |||||
5213 | |||||
6000 | |||||
6074 | |||||
6090 | |||||
6091 | |||||
6125 | |||||
6203 | |||||
In_multi_point (181) | |||||
In_pos_neg_data (12) | |||||
Description (2) | |||||
Reference (19) | |||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||
Method | Substitution_allele |