WormBase Tree Display for Variation: WBVar00143022
expand all nodes | collapse all nodes | view schema
WBVar00143022 | Evidence | Paper_evidence | WBPaper00027121 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | e188 | ||||||
Other_name | e188ts | |||||||
H27M09.4.1:c.415G>C | ||||||||
CE25036:p.Gly139Arg | ||||||||
HGVSg | CHROMOSOME_I:g.6844486G>C | |||||||
Sequence_details | SMap | S_parent | Sequence | H27M09 | ||||
Flanking_sequences | acatgccaacaaggaaaggctggaccacca | gaccaccaggagatgatggaaaggacggaa | ||||||
Mapping_target | H27M09 | |||||||
Type_of_mutation | Substitution | g | c | Paper_evidence | WBPaper00027121 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (62) | ||||||||
Laboratory | CB | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001075 | ||||||
Transcript | H27M09.4.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious | ||||||
PolyPhen | 1 | probably_damaging | ||||||
HGVSc | H27M09.4.1:c.415G>C | |||||||
HGVSp | CE25036:p.Gly139Arg | |||||||
cDNA_position | 449 | |||||||
CDS_position | 415 | |||||||
Protein_position | 139 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Gga/Cga | |||||||
Amino_acid_change | G/R | |||||||
Interactor | WBInteraction000518462 | |||||||
Genetics | Interpolated_map_position | I | 1.37773 | |||||
Mapping_data | In_2_point (6) | |||||||
In_multi_point (66) | ||||||||
In_pos_neg_data (55) | ||||||||
Description | Phenotype | WBPhenotype:0000035 | Paper_evidence | WBPaper00000031 | ||||
Curator_confirmed | WBPerson48 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ts lethal (25C). Lethality enhanced by Smg. ES3 (all stages 20C). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Temperature_sensitive | Heat_sensitive | 25 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000519 | Paper_evidence | WBPaper00033444 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutant strains tested showed altered fitness compared to wild type when exposed to different bacterial environments such as E. coli, M. luteus, and Pseudomonas sp.and B. megaterium | Paper_evidence | WBPaper00033444 | |||||
Curator_confirmed | WBPerson2021 | |||||||
WBPhenotype:0000583 | Paper_evidence | WBPaper00000031 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson48 | |||||||
WBPerson712 | ||||||||
Remark | Medium dumpy adult, strong dumpy L1 (20C). Easy to score (ES3) at all stages (20C). | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Ease_of_scoring | ES3_Easy_to_score | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000505 | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Males are not Ram. | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Temperature | 20C | Paper_evidence | WBPaper00001328 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | him-5(e1490) | Paper_evidence | WBPaper00001328 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001426 | Paper_evidence | WBPaper00004883 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | arIs37 | Paper_evidence | WBPaper00004883 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00001328 | |||||||
WBPaper00000031 | ||||||||
WBPaper00004883 | ||||||||
WBPaper00024024 | ||||||||
WBPaper00014397 | ||||||||
WBPaper00016102 | ||||||||
WBPaper00025792 | ||||||||
WBPaper00033444 | ||||||||
WBPaper00061175 | ||||||||
Remark (2) | ||||||||
Method | Substitution_allele |