WormBase Tree Display for Variation: WBVar00089937
expand all nodes | collapse all nodes | view schema
WBVar00089937 | Evidence | Paper_evidence | WBPaper00024442 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n1069 | |||||||
Other_name | CE27762:p.Gly565Glu | ||||||||
F55B12.3a.1:c.1700G>A | |||||||||
F55B12.3b.1:c.1694G>A | |||||||||
CE25007:p.Gly567Glu | |||||||||
HGVSg | CHROMOSOME_V:g.13822314G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F55B12 | |||||
Flanking_sequences | TTTGTTCTACTTCTACGATGCTAGCGTGTGCAGTCG | ATCTCGTAACAACACCGAGGAGACCAAAGTTATCCTTCTCGACTTTGATG | |||||||
Mapping_target | F55B12 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00004767 | |||||||
Transcript | F55B12.3b.1 (12) | ||||||||
F55B12.3a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | F55B12.3a.1:c.1700G>A | ||||||||
HGVSp | CE25007:p.Gly567Glu | ||||||||
cDNA_position | 1704 | ||||||||
CDS_position | 1700 | ||||||||
Protein_position | 567 | ||||||||
Exon_number | 12/13 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
Interactor | WBInteraction000052277 | ||||||||
Genetics | Interpolated_map_position | V | 5.62166 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00024442 | |||||
WBPaper00001133 | |||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
Remark | The penetrance of the egg-laying defect in n1069 heterozygotes is cold-sensitive. See Table 7 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | Incomplete | complete penetrance at 15 or 20 deg C | Paper_evidence | WBPaper00024442 | |||||
Curator_confirmed | WBPerson48 | ||||||||
As shown in Table 5, 78 percent of heterozygotes are Egl. Under homozygous conditions, 99 percent of hermaphrodites are Egl | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00024442 | |||||
Curator_confirmed | WBPerson48 | ||||||||
20 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show a 57 percent drop in brood size (compared to wild-type) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000683 | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Causes significant masculinization of hermaphrodites. | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Variation_effect | Neomorph_gain_of_function | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001024 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | At least one of the ventral hypodermal cells P3.p-P8.p, inappropriately divides once in all egl-41 males during the L4 stage. (P3.p-P8.p normally divide only in hermaphrodites to form the vulva) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance (2) | |||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 25 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001220 | Paper_evidence | WBPaper00001133 | |||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Authors comment mutations in egl-41 cause HSNs (which normally undergo apoptosis only in males) to die in hermaphrodites. | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
HSNs undergo embryonic apoptosis in hermaphrodites | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Cold_sensitive | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001275 | Paper_evidence | WBPaper00024442 | |||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Causes increased lin-12 signaling. | Paper_evidence | WBPaper00024442 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | See Table 1 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance (2) | |||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00016320 | ||||||||
WBPaper00016216 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00001133 | |||||||||
WBPaper00024442 | |||||||||
WBPaper00019447 | |||||||||
WBPaper00010313 | |||||||||
WBPaper00016717 | |||||||||
Method | Substitution_allele |