WormBase Tree Display for Variation: WBVar00248971

WBVar00248971 Evidence: Paper_evidence: WBPaper00026831
  Name: Public_name: sy327
    Other_name (12)
    HGVSg: CHROMOSOME_IV:g.7688241A>C
  Sequence_details: SMap: S_parent: Sequence: F33D4
    Flanking_sequences: tgcgacggtggaaacatatttgatgggttt agaaatcaatccatggaagagagacaaagt
    Mapping_target: F33D4
    Type_of_mutation: Substitution: a y Paper_evidence: WBPaper00026831
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00030857
    Laboratory: PS
    Status: Live
  Affects: Gene: WBGene00002173
    Transcript: F33D4.2d.1 (12)
      F33D4.2g.1 (12)
      F33D4.2a.1 (12)
      F33D4.2f.1 (12)
      F33D4.2h.1 VEP_consequence: missense_variant
        VEP_impact: MODERATE
        SIFT: 0 deleterious
        PolyPhen: 0.998 probably_damaging
        HGVSc: F33D4.2h.1:c.2727A>C
        HGVSp: CE44684:p.Leu909Phe
        cDNA_position: 2727
        CDS_position: 2727
        Protein_position: 909
        Exon_number: 15/34
        Codon_change: ttA/ttC
        Amino_acid_change: L/F
      F33D4.2e.1 (12)
    Interactor: WBInteraction000050845
      WBInteraction000050846
      WBInteraction000050847
      WBInteraction000576761
      WBInteraction000576764
  Genetics: Interpolated_map_position: IV 3.37929
  Description: Phenotype (3)
    Phenotype_not_observed: WBPhenotype:0000207 Paper_evidence: WBPaper00028479
        Curator_confirmed: WBPerson2987
        Remark: Figure 6A Paper_evidence: WBPaper00028479
            Curator_confirmed: WBPerson2987
  Reference: WBPaper00031535
    WBPaper00026831
    WBPaper00028479
    WBPaper00003017
  Remark: Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002173 Missense 899 L to F Paper_evidence: WBPaper00026831
  Method: Substitution_allele