WormBase Tree Display for Variation: WBVar00248971
expand all nodes | collapse all nodes | view schema
WBVar00248971 | Evidence | Paper_evidence | WBPaper00026831 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | sy327 | ||||||
Other_name (12) | ||||||||
HGVSg | CHROMOSOME_IV:g.7688241A>C | |||||||
Sequence_details | SMap | S_parent | Sequence | F33D4 | ||||
Flanking_sequences | tgcgacggtggaaacatatttgatgggttt | agaaatcaatccatggaagagagacaaagt | ||||||
Mapping_target | F33D4 | |||||||
Type_of_mutation | Substitution | a | y | Paper_evidence | WBPaper00026831 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00030857 | |||||||
Laboratory | PS | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00002173 | ||||||
Transcript | F33D4.2d.1 (12) | |||||||
F33D4.2g.1 (12) | ||||||||
F33D4.2a.1 (12) | ||||||||
F33D4.2f.1 (12) | ||||||||
F33D4.2h.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | |||||||
SIFT | 0 | deleterious | ||||||
PolyPhen | 0.998 | probably_damaging | ||||||
HGVSc | F33D4.2h.1:c.2727A>C | |||||||
HGVSp | CE44684:p.Leu909Phe | |||||||
cDNA_position | 2727 | |||||||
CDS_position | 2727 | |||||||
Protein_position | 909 | |||||||
Exon_number | 15/34 | |||||||
Codon_change | ttA/ttC | |||||||
Amino_acid_change | L/F | |||||||
F33D4.2e.1 (12) | ||||||||
Interactor (5) | ||||||||
Genetics | Interpolated_map_position | IV | 3.37929 | |||||
Description | Phenotype | WBPhenotype:0000145 | Paper_evidence | WBPaper00003017 | ||||
Curator_confirmed | WBPerson625 | |||||||
Remark | suppresses let-23 sterilty (ovulation) | Paper_evidence | WBPaper00003017 | |||||
Curator_confirmed | WBPerson625 | |||||||
Phenotype_assay | Genotype | let-23(sy10) | Paper_evidence | WBPaper00003017 | ||||
Curator_confirmed | WBPerson625 | |||||||
WBPhenotype:0000209 | Paper_evidence | WBPaper00031535 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We obtained animals in which the itr-1(sy327) mutation was linked to unc-24(e138) (0.14 cM apart), and we have been unable to isolate itr-1(sy327) single mutants. Therefore, we compared the effect of VPA between itr-1(sy327) unc-24(e138) double mutants and unc-24(e138) single mutants. Single unc-24(e138) mutants had a slightly elongated defecation cycle, however, the cycle was elongated in response to VPA addition equivalent to that of wild-type animals (Figure 3A). The ability of VPA to increase defecation cycle length was strongly reduced by the itr-1(sy327) gain-of-function mutation [VPA-mediated increases in mean defecation cycle length were 16.3 +/- 4.0 s in wild type, 15.0 +/- 7.8 s in unc-24(e138), and 7.4 +/- 1.6 s in itr-1(sy327) unc-24(e138) double mutants]. VPA-mediated increases in the variability of defecation cycle length were also strongly suppressed by the itr-1(sy327) gain-of-function mutation (Figure 3, B and C)." | Paper_evidence | WBPaper00031535 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004943 | Paper_evidence | WBPaper00031535 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | unc-24(e138) | Paper_evidence | WBPaper00031535 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001926 | Paper_evidence | WBPaper00031535 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | "We also tested whether the itr-1(sy327) gain-of-function mutation also suppressed VPA defects in the IP3-regulated basal sheath cell contractions. VPA decreased the sheath cell contraction rate of unc-24(e138) control animals; however, itr-1(sy327) unc-24(e138) double mutants were not affected by VPA (Figure 2C)." | Paper_evidence | WBPaper00031535 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Affected_by | Molecule | WBMol:00004943 | Paper_evidence | WBPaper00031535 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | unc-24(e138) | Paper_evidence | WBPaper00031535 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_not_observed | WBPhenotype:0000207 | Paper_evidence | WBPaper00028479 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Figure 6A | Paper_evidence | WBPaper00028479 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00031535 | |||||||
WBPaper00026831 | ||||||||
WBPaper00028479 | ||||||||
WBPaper00003017 | ||||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002173 Missense 899 L to F | Paper_evidence | WBPaper00026831 | |||||
Method | Substitution_allele |