WormBase Tree Display for Variation: WBVar00248971
expand all nodes | collapse all nodes | view schema
WBVar00248971 | Evidence | Paper_evidence | WBPaper00026831 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | sy327 | |||||
Other_name (12) | |||||||
HGVSg | CHROMOSOME_IV:g.7688241A>C | ||||||
Sequence_details | SMap | S_parent | Sequence | F33D4 | |||
Flanking_sequences | tgcgacggtggaaacatatttgatgggttt | agaaatcaatccatggaagagagacaaagt | |||||
Mapping_target | F33D4 | ||||||
Type_of_mutation | Substitution | a | y | Paper_evidence | WBPaper00026831 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00030857 | ||||||
Laboratory | PS | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00002173 | |||||
Transcript | F33D4.2d.1 (12) | ||||||
F33D4.2g.1 (12) | |||||||
F33D4.2a.1 (12) | |||||||
F33D4.2f.1 (12) | |||||||
F33D4.2h.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 0.998 | probably_damaging | |||||
HGVSc | F33D4.2h.1:c.2727A>C | ||||||
HGVSp | CE44684:p.Leu909Phe | ||||||
cDNA_position | 2727 | ||||||
CDS_position | 2727 | ||||||
Protein_position | 909 | ||||||
Exon_number | 15/34 | ||||||
Codon_change | ttA/ttC | ||||||
Amino_acid_change | L/F | ||||||
F33D4.2e.1 (12) | |||||||
Interactor | WBInteraction000050845 | ||||||
WBInteraction000050846 | |||||||
WBInteraction000050847 | |||||||
WBInteraction000576761 | |||||||
WBInteraction000576764 | |||||||
Genetics | Interpolated_map_position | IV | 3.37929 | ||||
Description (2) | |||||||
Reference | WBPaper00031535 | ||||||
WBPaper00026831 | |||||||
WBPaper00028479 | |||||||
WBPaper00003017 | |||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00002173 Missense 899 L to F | Paper_evidence | WBPaper00026831 | ||||
Method | Substitution_allele |