WormBase Tree Display for Variation: WBVar00088778
expand all nodes | collapse all nodes | view schema
WBVar00088778 | Evidence | Paper_evidence | WBPaper00002025 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | mc1 | |||||||
Other_name | F18A1.2c.1:c.1049G>A | ||||||||
F18A1.2a.1:c.947G>A | |||||||||
F18A1.2d.1:c.1103G>A | |||||||||
F18A1.2b.1:c.947G>A | |||||||||
CE27972:p.Gly316Glu | |||||||||
CE48778:p.Gly316Glu | |||||||||
CE52355:p.Gly368Glu | |||||||||
CE04402:p.Gly350Glu | |||||||||
HGVSg | CHROMOSOME_II:g.7683466G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | F18A1 | |||||
Flanking_sequences | gtggaaagccaacaacactcaactcaacag | atctcgttggaatcttctgcgccacgtcat | |||||||
Mapping_target | F18A1 | ||||||||
Type_of_mutation | Substitution | g | a | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026565 | ||||||||
Laboratory | ML | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00003012 | |||||||
Transcript | F18A1.2d.1 | VEP_consequence | missense_variant | ||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious_low_confidence | |||||||
PolyPhen | 0.999 | probably_damaging | |||||||
HGVSc | F18A1.2d.1:c.1103G>A | ||||||||
HGVSp | CE52355:p.Gly368Glu | ||||||||
cDNA_position | 1103 | ||||||||
CDS_position | 1103 | ||||||||
Protein_position | 368 | ||||||||
Exon_number | 3/5 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
F18A1.2b.1 (12) | |||||||||
F18A1.2a.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | F18A1.2a.1:c.947G>A | ||||||||
HGVSp | CE27972:p.Gly316Glu | ||||||||
cDNA_position | 947 | ||||||||
CDS_position | 947 | ||||||||
Protein_position | 316 | ||||||||
Exon_number | 2/5 | ||||||||
Codon_change | gGa/gAa | ||||||||
Amino_acid_change | G/E | ||||||||
F18A1.2c.1 (12) | |||||||||
Genetics | Interpolated_map_position | II | 0.516415 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000877 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0000951 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0008379 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
WBPhenotype:0002569 | Paper_evidence | WBPaper00002551 | |||||||
Curator_confirmed | WBPerson351 | ||||||||
Remark | the outline of hypodermal nuclei became more difficult to distinguish in the strong mutant mc1 or mc4, suggesting a cell death or degenereration process | Paper_evidence | WBPaper00002551 | ||||||
Curator_confirmed | WBPerson351 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00002551 | ||||
Curator_confirmed | WBPerson351 | ||||||||
GO_term | GO:0005634 | PATO:0000460 | Paper_evidence | WBPaper00002551 | |||||
Curator_confirmed | WBPerson351 | ||||||||
Reference | WBPaper00022573 | ||||||||
WBPaper00015331 | |||||||||
WBPaper00014675 | |||||||||
WBPaper00021716 | |||||||||
WBPaper00002551 | |||||||||
Method | Substitution_allele |