WormBase Tree Display for Variation: WBVar00142948
expand all nodes | collapse all nodes | view schema
WBVar00142948 | Evidence | Paper_evidence | WBPaper00001431 | |||
---|---|---|---|---|---|---|
Person_evidence | WBPerson267 | |||||
Name | Public_name | e73 | ||||
Other_name | CE09197:p.Glu342Lys | |||||
F07A5.7a.2:c.1024G>A | ||||||
F07A5.7b.1:c.67G>A | ||||||
F07A5.7a.1:c.1024G>A | ||||||
CE42754:p.Glu23Lys | ||||||
HGVSg | CHROMOSOME_I:g.7379262C>T | |||||
Sequence_details | SMap | S_parent | Sequence | F07A5 | ||
Flanking_sequences | gagatcatgctccagaagatttctcaactc | agaaggccaagtctcgtcttcaatctgagg | ||||
Mapping_target | F07A5 | |||||
Type_of_mutation | Substitution | G | A | |||
SeqStatus | Sequenced | |||||
Variation_type | Allele | |||||
Origin | Species | Caenorhabditis elegans | ||||
Strain (35) | ||||||
Laboratory | CB | |||||
Status | Live | |||||
Affects | Gene | WBGene00006754 | ||||
Transcript | F07A5.7a.1 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | |||||
SIFT | 0 | deleterious | ||||
PolyPhen | 0.999 | probably_damaging | ||||
HGVSc | F07A5.7a.1:c.1024G>A | |||||
HGVSp | CE09197:p.Glu342Lys | |||||
cDNA_position | 1138 | |||||
CDS_position | 1024 | |||||
Protein_position | 342 | |||||
Exon_number | 9/14 | |||||
Codon_change | Gag/Aag | |||||
Amino_acid_change | E/K | |||||
F07A5.7a.2 (12) | ||||||
F07A5.7b.1 (12) | ||||||
Interactor (3) | ||||||
Isolation | Mutagen | EMS | ||||
Forward_genetics | standard phenotypic screen | |||||
Genetics | Interpolated_map_position | I | 2.05567 | |||
Mapping_data | In_2_point | 13 | ||||
238 | ||||||
516 | ||||||
1017 | ||||||
In_multi_point (14) | ||||||
In_pos_neg_data | 515 | |||||
2518 | ||||||
4992 | ||||||
4999 | ||||||
5003 | ||||||
5345 | ||||||
Description | Phenotype (10) | |||||
Reference (31) | ||||||
Remark | Manually curated Gene associations preserved as a text remark so that VEP is the canonical predictor of consequence: WBGene00006754 Missense 342 E to K | |||||
Method | Substitution_allele |