WormBase Tree Display for Variation: WBVar00145365
expand all nodes | collapse all nodes | view schema
WBVar00145365 | Evidence | Paper_evidence | WBPaper00002004 | ||||
---|---|---|---|---|---|---|---|
Name | Public_name | g25 | |||||
Other_name (4) | |||||||
HGVSg | CHROMOSOME_X:g.16383163C>T | ||||||
Sequence_details | SMap | S_parent | Sequence | F01G12 | |||
Flanking_sequences | caggacaagacggccttccagggcgtgatg | cctcccaggagtcccaggacaaaagggaga | |||||
Mapping_target | F01G12 | ||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002004 | ||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00007827 | ||||||
WBStrain00007843 | |||||||
Laboratory | RC | ||||||
GG | |||||||
Status | Live | ||||||
Affects | Gene | WBGene00002280 | |||||
Transcript | F01G12.5b.1 (12) | ||||||
F01G12.5a.1 | VEP_consequence | missense_variant | |||||
VEP_impact | MODERATE | ||||||
SIFT | 0 | deleterious | |||||
PolyPhen | 1 | probably_damaging | |||||
HGVSc | F01G12.5a.1:c.3374G>A | ||||||
HGVSp | CE04334:p.Gly1125Asp | ||||||
cDNA_position | 3387 | ||||||
CDS_position | 3374 | ||||||
Protein_position | 1125 | ||||||
Exon_number | 15/20 | ||||||
Codon_change | gGc/gAc | ||||||
Amino_acid_change | G/D | ||||||
Isolation | Mutagen | EMS | Paper_evidence | WBPaper00002004 | |||
Genetics | Interpolated_map_position | X | 23.9188 | ||||
Mapping_data | In_2_point | 603 | |||||
604 | |||||||
Reference | WBPaper00032451 | ||||||
WBPaper00010141 | |||||||
WBPaper00025799 | |||||||
WBPaper00061173 | |||||||
Remark | Variation stub/paper connection generated from the May 2021 NN VFP dataset. | ||||||
Created by WBPerson51134 from the NN_VFP_triage_pipeline | |||||||
Method | Substitution_allele |