WormBase Tree Display for Variation: WBVar00089862
expand all nodes | collapse all nodes | view schema
WBVar00089862 | Name | Public_name | n986 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | n987 | Paper_evidence | WBPaper00003631 | ||||||
n2164 | Paper_evidence | WBPaper00003631 | |||||||
Sequence_details | SMap | S_parent | Sequence | VF23B12L | |||||
Flanking_sequences | TTTTATTGGGTATTGTTTACTCCTAACCGG | TGGTCCATAAAATTCTATTGTCCCAGATTT | |||||||
Mapping_target | VF23B12L | ||||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00003631 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00027000 | ||||||||
WBStrain00027011 | |||||||||
WBStrain00027054 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001170 | |||||||
Interactor | WBInteraction000586831 | ||||||||
Genetics | Interpolated_map_position | V | 6.30574 | ||||||
Mapping_data | In_multi_point | 941 | |||||||
2264 | |||||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The penetrance of the egg-laying defect in ced-3(n717)/+ ; n986/+ heterozygotes is heat- sensitive. | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | As shown in Table 5, 99 percent of heterozygotes are Egl. Under homozygous conditions, 100 percent of hermaphrodites are Egl | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000154 | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Mutants show a 40 percent drop in brood size (compared to wild-type) | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000207 | Paper_evidence | WBPaper00056479 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Surprisingly, animals bearing two independent egl-1(dm) mutants that cause the HSNs to undergo premature cell death showed a decrease in DMP frequency (Figure 1B). | Paper_evidence | WBPaper00056479 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000339 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stronger, non-ts allele than n487 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001172 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stronger, non-ts allele than n487 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001220 | Paper_evidence | WBPaper00001133 | |||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | HSNs (which normally undergo apoptosis only in males) die in the mutant hermaphrodites. Authors comment it seems likely that egl-1 mutations cause the cell-specific sexual transformation of hermaphrodite HSNs. | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
HSNs undergo embryonic apoptosis in hermaphrodites. | Paper_evidence | WBPaper00001105 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0006830 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
WBPaper00001105 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | Paper_evidence | WBPaper00001105 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001340 | Paper_evidence | WBPaper00001133 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | See Table 1 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
stronger, non-ts allele than n487 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 83 | 83 | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 0.75 mg/ml imipramine | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001818 | Paper_evidence | WBPaper00032221 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | VC neurons were largely inactive, even under low-osmolarity conditions. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005304 | PATO:0000460 | Paper_evidence | WBPaper00032221 | ||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested in low or high osmolarity. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_not_observed | WBPhenotype:0001068 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Dominant | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001073 | Paper_evidence | WBPaper00003951 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Egg-laying behavior in egl-1 mutants was strongly regulated by food | Paper_evidence | WBPaper00003951 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001629 | Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | stronger, non-ts allele than n487 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001816 | Paper_evidence | WBPaper00032221 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | VC activity was observed to be temporally coupled with egg laying events. | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Phenotype_assay | Treatment | Animals were tested in the presence of 50ul 10mg/ml serotonin in M9 to stimulate egg laying. Combined fluorescent and visible microscopy was used to view both the Ca2+ signal and egg laying events simultaneously. Animals were assayed 24 hr after the late fourth larval (L4) stage at 20.5C 0.5C. | Paper_evidence | WBPaper00032221 | |||||
Curator_confirmed | WBPerson712 | ||||||||
Genotype | Cameleon IjIs25[myo-3::YC2.0] | Paper_evidence | WBPaper00032221 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00032221 | ||||||||
WBPaper00020957 | |||||||||
WBPaper00013864 | |||||||||
WBPaper00003951 | |||||||||
WBPaper00014768 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00001133 | |||||||||
WBPaper00056479 | |||||||||
WBPaper00003631 | |||||||||
Method | Substitution_allele |