WormBase Tree Display for Variation: WBVar00089533
expand all nodes | collapse all nodes | view schema
WBVar00089533 | Evidence | Paper_evidence | WBPaper00032921 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | n486 | |||||||
Other_name | CE34523:p.Arg162Cys | ||||||||
C08C3.1b.1:c.487C>T | |||||||||
CE29076:p.Arg159Cys | |||||||||
C08C3.1a.1:c.475C>T | |||||||||
C08C3.1c.1:c.484C>T | |||||||||
CE32792:p.Arg163Cys | |||||||||
HGVSg | CHROMOSOME_III:g.7816155C>T | ||||||||
Sequence_details | SMap | S_parent | Sequence | C08C3 | |||||
Flanking_sequences | agatcgtcaaatcaaaatctggttccaaaat | gtcgaatgaaggcgaaaaaagagaagcaaag | |||||||
Mapping_target | C08C3 | ||||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00032921 | ||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00026786 | ||||||||
WBStrain00030544 | |||||||||
Laboratory | MT | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00001174 | |||||||
Transcript | C08C3.1b.1 (12) | ||||||||
C08C3.1c.1 | VEP_consequence | missense_variant | |||||||
VEP_impact | MODERATE | ||||||||
SIFT | 0 | deleterious | |||||||
PolyPhen | 1 | probably_damaging | |||||||
HGVSc | C08C3.1c.1:c.484C>T | ||||||||
HGVSp | CE34523:p.Arg162Cys | ||||||||
cDNA_position | 581 | ||||||||
CDS_position | 484 | ||||||||
Protein_position | 162 | ||||||||
Exon_number | 5/6 | ||||||||
Codon_change | Cgt/Tgt | ||||||||
Amino_acid_change | R/C | ||||||||
C08C3.1a.1 (12) | |||||||||
Interactor (7) | |||||||||
Genetics | Interpolated_map_position | III | -0.582044 | ||||||
Mapping_data | In_2_point | 716 | |||||||
In_multi_point | 611 | ||||||||
868 | |||||||||
In_pos_neg_data | 1621 | ||||||||
Description | Phenotype (38) | ||||||||
Phenotype_not_observed | WBPhenotype:0000099 | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | egl-5(n486)/+ heterozygotes did not display a "2 P11.p" phenotype where P12 adopts a P11 fate | Paper_evidence | WBPaper00005344 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0000594 | Paper_evidence | WBPaper00004662 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | "We therefore determined the orientation of P(11/12)L/R migration in mutants affecting P12 determination: a lin-44; lin-3 double mutant, a lin-17 mutant (LIN-17 is the putative receptor of Wnt/LIN-44; Herman et_al, 1995; Sawa et_al, 1996), a bar-1 mutant (BAR-1/Armadillo is an effector of the Wnt pathway; Eisenmann et_al, 1998), and an egl-5 mutant. In all mutants observed, both cells of the P11/12 pair generally adopt the P11 fate (Table 1A). If the migration handedness was a consequence of fate determination, it should be unbiased in these mutants. However, we see a biased migration pattern of P(11/12)L/R similar to that of wild type (Table 1A). Thus, a left-right asymmetry between the two cells of the P11/12 pair still exists in mutants of their final fate determination." | Paper_evidence | WBPaper00004662 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0004409 | PATO:0000460 | Paper_evidence | WBPaper00004662 | ||||
Curator_confirmed | WBPerson2987 | ||||||||
WBPhenotype:0001068 | Paper_evidence | WBPaper00000635 | |||||||
WBPaper00001133 | |||||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson2021 | |||||||||
WBPerson712 | |||||||||
Remark | Stimulated by serotonin. | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00001133 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | 5 mg/ml serotonin | Paper_evidence | WBPaper00000635 | |||||
Curator_confirmed | WBPerson48 | ||||||||
7.5 mg/ml serotonin | Paper_evidence | WBPaper00001133 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature | 24 | Paper_evidence | WBPaper00001133 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001645 | Paper_evidence | WBPaper00040284 | |||||||
Curator_confirmed | WBPerson2987 | ||||||||
Remark | Table 1 | Paper_evidence | WBPaper00040284 | ||||||
Curator_confirmed | WBPerson2987 | ||||||||
Reference | WBPaper00040284 | ||||||||
WBPaper00043908 | |||||||||
WBPaper00005344 | |||||||||
WBPaper00000635 | |||||||||
WBPaper00014695 | |||||||||
WBPaper00001105 | |||||||||
WBPaper00001133 | |||||||||
WBPaper00013865 | |||||||||
WBPaper00004662 | |||||||||
Method | Substitution_allele |