WormBase Tree Display for Transgene: WBTransgene00018352
expand all nodes | collapse all nodes | view schema
WBTransgene00018352 | Public_name | WBPaper00042147Ex1 | |
---|---|---|---|
Summary | [Pglb-13::GFP] | ||
Synonym | Expr10793_Ex | ||
Construction | Construct | WBCnstr00017737 | |
Construction_summary | The gene fusion consisted of 1,881 bp upstream promoter and the enhancer regions for glb-13 gene to the coding region of GFP. The primer sequences were used: forward: 5' -TTAATTGTTATTTTCGACCATTCC-3'and reverse: 5' -AGTCGACCTGCAGGCATGCAAGCTTTTGGGTTCATGGGTTCAAAGGAAC AAGG-3'. -- precise ends. | ||
Genetic_information | Extrachromosomal | ||
Used_for | Expr_pattern | Expr10793 | |
Reference | WBPaper00042147 | ||
Species | Caenorhabditis elegans |