WormBase Tree Display for Transgene: WBTransgene00008384
expand all nodes | collapse all nodes | view schema
WBTransgene00008384 | Public_name | mcEx539 | |
---|---|---|---|
Summary | [Pgei-16E::GEI-16::GFP] | ||
Synonym | gei-16E | ||
Construction | Construct | WBCnstr00008093 | |
Coinjection | WBCnstr00004720 | ||
Construction_summary | This translational GFP reporter for isoforms E/F/I was created by PCR fusion, using a promoter PCR product and a GFP PCR product using the primers 5'-tgcaatacgtccacctgaaa and 5'-gagtcgacctgcaggcatgcaagctacgacgacgtctatcatcattcag (promoter and coding sequence), 5'-agcttgcatgcctgcaggtcgact and 5'-tctgtgcggtatttcacacc (GFP coding sequence and unc-54 3'UTR from the plasmid pPD95.75). The final product was PCR products were inserted at the AgeI site of the vector pPD95.75 (Addgene). | ||
Genetic_information | Extrachromosomal | ||
Used_for | Expr_pattern | Expr11571 | |
Reference | WBPaper00037850 | ||
Species | Caenorhabditis elegans |