WormBase Tree Display for Strain: WBStrain00055641
expand all nodes | collapse all nodes | view schema
WBStrain00055641 | Genotype | drl-1(hd7062[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ IV. | ||
---|---|---|---|---|
Public_name | VH7062 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006789 | ||||
WBGene00017578 | ||||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 06 Sep 2023 00:00:00 | |||
Location | CGC | |||
Remark | Heterozygous strain, might not be homozygous viable. Deletion of 1309 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: AGTTTGAATTGAAAAGGGAGTGGTTTCCCT; Right flanking sequence: CGGCATTGAGTCTGGCGGCTGTTGCCGGTG. sgRNA #1: CCGATTCCGTTCCTAATCAC; sgRNA #2: GATTGGAATGGTGTTATGCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: VH KO group | CGC_data_submission | |||
Species | Caenorhabditis elegans |