Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00055505

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00055505Genotypecyp-33B1(ve862[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V.
Public_nameRG3362
ContainsGeneWBGene00003514
WBGene00004496
WBGene00006789
PropertiesMutagenCRISPR_Cas9
CGC_received31 May 2023 00:00:00
LocationCGC
RemarkHomozygous viable. Deletion of 2219 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: CTTTTCTTCCTTATTCATCAATATTTGTGG ; Right flanking sequence: CGCGTTAGATCACGAAATTGTCACACTGAA. cyp-33B1 sgRNA #1: CGGCGAAGAGGATTACCACC; cyp-33B1 sgRNA #2: ACATTTATATGGAATGACAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Inferred_automaticallyFrom CGC strain data
Made_by: RG KO GroupCGC_data_submission
SpeciesCaenorhabditis elegans