WormBase Tree Display for Strain: WBStrain00055495
expand all nodes | collapse all nodes | view schema
| WBStrain00055495 | Genotype | asp-5(ve852[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | ||
|---|---|---|---|---|
| Public_name | RG3352 | |||
| Contains | Gene | WBGene00000218 | ||
| WBGene00003514 | ||||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| Properties | Mutagen | CRISPR_Cas9 | ||
| CGC_received | 18 Apr 2023 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Deletion of 1561 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: TCACGACCATTTTTCCAGGTATGAAGACCA ; Right flanking sequence: GGGATTCGCCAACTCCCTTCAGGCCAATTA. asp-5 sgRNA #1: GGCAACTAGTGCTACGAAAG; asp-5 sgRNA #2: GATATTGGAGGACAACGTAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
| Made_by: RG KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
