Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00055352

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00055352Genotypeasp-12(sy1899) V.
Public_namePS9705
ContainsGeneWBGene00017678
VariationWBVar02159092
Properties (3)
LocationCGC
RemarkSuperficially wild type. CRISPR/Cas9 engineered STOP-IN null mutant of asp-12. Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: GAATCGCCAAAGATGCAAATGATGAGGCGAGGAGA. Right flanking sequence: ATGGGGAGCATACGTTCAACACAAGGCTGCCCTAC. Inserted sequence between the two-flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: ATGATGAGGCGAGGAGAATG Method Reference: Wang H, et al. G3 (Bethesda). 2018 Nov 6;8(11):3607-3616.Inferred_automaticallyFrom CGC strain data
Made_by: Heenam ParkCGC_data_submission
SpeciesCaenorhabditis elegans