WormBase Tree Display for Strain: WBStrain00054678
expand all nodes | collapse all nodes | view schema
| WBStrain00054678 | Genotype | cat-2(cer181[cat-2p::gfp::H2B 1-3]) II. | ||
|---|---|---|---|---|
| Public_name | CER588 | |||
| Contains | Gene | WBGene00000296 | ||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 29 Jul 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | Abnormal locomotion can be rescued with dopamine. cat-2(cer181) is a complete deletion of the cat-2 gene (coding sequence + introns), which was substituted by the sequence of the step 1 repair for GFP::H2B (Nested CRISPR, Vicencio et al, Genetics 2019). Allele can be detected using the following primers: Fwd: ctatgtgaagtcacacctgtc Rev: cttgctggaagtgtacttggtg. Reference: Martnez-Fernndez C, et al. Dis Model Mech. 2022 Mar 1;15(3):dmm049161. doi: 10.1242/dmm.049161. PMID: 35107130 | Inferred_automatically | From CGC strain data | |
| Made_by: Carmen Martnez-Fernndez | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
