Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Strain: WBStrain00051696

expand all nodes | collapse all nodes | view schema

Name Class

WBStrain00051696StatusLive
Genotypeasp-3(utx47[mNG::3xFlag::asp-3]) X.
Public_nameGLW57
ContainsGeneWBGene00000216
Properties (3)
LocationCGC
RemarkN-terminal tag of ASP-3 via CRISPR/Cas9 knock-in of mNeonGreen at asp-3 locus. Insertion verified by PCR and fluorescence. Left flank: 5' gcgctgcttctcaattagtgataacgcacc 3'; Right flank: 5' ATGTCGGGCCGCGTTTTCCTTCTTCTGGCT 3'; sgRNA: tagtgataacgcaccATGT (19 bp); Cas9/sgRNA plasmid: pGLOW74; mNG^SEC^3xFlag plasmid: pGLOW96; SEC insertion allele strain: GLW58.Inferred_automaticallyFrom CGC strain data
Made_by: Stephen Pullman (Glow Worms '21)CGC_data_submission
SpeciesCaenorhabditis elegans