WormBase Tree Display for Strain: WBStrain00051694
expand all nodes | collapse all nodes | view schema
| WBStrain00051694 | Status | Live | ||
|---|---|---|---|---|
| Genotype | hsp-4(utx39[hsp-4::mNG::3xFlag]) II. | |||
| Public_name | GLW47 | |||
| Contains | Gene | WBGene00002008 | ||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 24 Jan 2022 00:00:00 | |||
| Location | CGC | |||
| Remark | C-terminal tag of HSP-4 via CRISPR/Cas9 knock-in of mNeonGreen at hsp-4 locus. Insertion verified by PCR and fluorescence. Left flank: 5' TCGGCCGGAGGACAAGGAGAACAAGCTTCTGAGGAGCCATCGGAGGATCATGATGAACTG 3' (1 silent mutation); Right flank: 5' TAAaatattaattgccttcaactacttgct 3'; sgRNA: CGTCTCCAAACTTTACTCGG; Cas9/sgRNA plasmid: pGLOW44; mNG^SEC^3xFlag plasmid: pGLOW61; SEC insertion allele strain: GLW46. | Inferred_automatically | From CGC strain data | |
| Made_by: Quincy Martin (Glow Worms '21) | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
