WormBase Tree Display for Strain: WBStrain00049444
expand all nodes | collapse all nodes | view schema
WBStrain00049444 | Evidence | Curator_confirmed | WBPerson1983 | |
---|---|---|---|---|
Status | Live | |||
Genotype | F19C7.2(ve705[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) IV. | |||
Public_name | RG3205 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006789 | ||||
Variation | WBVar02154263 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 14 Apr 2021 00:00:00 | |||
Location | CGC | |||
Remark | Homozygous viable. Deletion of 2784 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: aattaataggactttccaaaaaattgttga ; Right flanking sequence: AGgtgagtttttgcgtcttgataaaaaatc. sgRNA #1: actgaaatcaaattggtctt; sgRNA #2: GCACAGGCTATTAGGACTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: RG KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |