WormBase Tree Display for Strain: WBStrain00049436
expand all nodes | collapse all nodes | view schema
WBStrain00049436 | Evidence | Curator_confirmed | WBPerson1983 | |
---|---|---|---|---|
Status | Live | |||
Genotype | Y54G2A.75(ve697[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/tmC25[unc-5(tm9708)] IV. | |||
Public_name | RG3197 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006745 | ||||
WBGene00006789 | ||||
Variation | WBVar02154255 | |||
WBVar02148984 | ||||
Rearrangement | tmC25 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 14 Apr 2021 00:00:00 | |||
Location | CGC | |||
Remark | Homozygous larval lethal. Deletion of 635 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+dead larvae (ve697 homozygotes) and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Maintain by picking wild-type GFP+. Left flanking Sequence: ccgaaatgccgcatcgcgtgttgtttagcc; Right flanking sequence: TGGAGCTCGTAAAGGACGTGGTCTTGTCAT. sgRNA #1: atcgcgtgttgtttagccag; sgRNA #2: ATCATCGAGACGGTCTATCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: RG KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |