WormBase Tree Display for Strain: WBStrain00049357
expand all nodes | collapse all nodes | view schema
WBStrain00049357 | Evidence | Curator_confirmed | WBPerson1983 | |
---|---|---|---|---|
Status | Live | |||
Genotype | col-155(ve618[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) V. | |||
Public_name | RG3118 | |||
Contains | Gene | WBGene00000728 | ||
WBGene00003514 | ||||
WBGene00004496 | ||||
WBGene00006789 | ||||
Variation | WBVar02154177 | |||
Properties (3) | ||||
Location | CGC | |||
Remark | Homozygous viable. Deletion of 1138 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: gaaattctgaatcatatatttttcaatcat ; Right flanking sequence: gtattgcaattacacttggcagatgcaat. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: RG KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |