WormBase Tree Display for Strain: WBStrain00048566
expand all nodes | collapse all nodes | view schema
| WBStrain00048566 | Status | Live | ||
|---|---|---|---|---|
| Genotype | cyb-3(lt110) V/nT1 [qIs51] (IV;V). | |||
| Public_name | OD3737 | |||
| Contains | Gene | WBGene00000868 | ||
| Variation | WBVar02153471 | |||
| Rearrangement | nT1 | |||
| Transgene | WBTransgene00001903 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 14 Feb 2023 00:00:00 | |||
| Location | OD | |||
| CGC | ||||
| Made_by | WBPerson29989 | |||
| Remark | Generated from papers flagged positive during the last month for data type afp_strain/other_strain. | |||
| CRISPR/Cas9 engineered deletion of cyb-3. Heterozygotes are wild-type GFP+ and segregate mdf-2 null homozygotes (embryonic lethal), wild-type GFP+ heterozygotes, and arrested nT1[qIs51] aneuploids. Pick wild-type GFP+ and check for correct segregation of progeny to maintain. gRNA sequences: tcaggtcgacattcttggcc & gttatgggtatgagagcatt Reference: Lara-Gonzalez P, et al. Dev Cell. 2019 Nov 4;51(3):313-325.e10. doi: 10.1016/j.devcel.2019.09.005. PMID: 31588029. | Inferred_automatically | From CGC strain data | ||
| Reference | WBPaper00059904 | |||
| Species | Caenorhabditis elegans |
