WormBase Tree Display for Strain: WBStrain00047561
expand all nodes | collapse all nodes | view schema
| WBStrain00047561 | Status | Live | ||
|---|---|---|---|---|
| Genotype | gpa-14(gk5176) I. | |||
| Public_name | VC4088 | |||
| Contains | Gene | WBGene00001676 | ||
| Variation | WBVar02152972 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | EMS | |||
| CGC_received | 05 Nov 2019 00:00:00 | |||
| Location | CGC | |||
| Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5176 mutation is T->A, flanking sequences ACCTCTGGATCCAATTGAACATATTACATA and GAAATTGATGAAATCTATGCTCCAATGTCT. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
