WormBase Tree Display for Strain: WBStrain00039046
expand all nodes | collapse all nodes | view schema
WBStrain00039046 | Status | Live | ||
---|---|---|---|---|
Genotype | Whole-genome sequenced strain. | |||
Public_name | VC40060 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006789 | ||||
WBGene00017901 | ||||
Variation (396) | ||||
Properties | Outcrossed | x0 | ||
Mutagen | EMS+ENU | |||
CGC_received (2) | ||||
Location | CGC | |||
Remark | This strain was provided by the C. elegans Reverse Genetics Core Facility at the University of British Columbia, which is part of the international C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00042537 | |
Million Mutation Project strain. This strain was isolated after EMS+ENU mutagenesis of VC2010, propagated clonally through F10 to drive mutations to homozygosity, and subjected to whole-genome sequencing. It is homozygous for a large number of mutations determined from sequence data. It may also carry large copy number variations that are not homozygous. Alleles numbered between gk100000 and gk962522 are homozygous; those numbered from gk962523 up should be assumed to be non-homozygous. A graphical representation of these large copy number differences can be seen in the Plot section for each strain on the MMP web site ( URL: genome.sfu.ca/mmp/). | Inferred_automatically | From CGC strain data | ||
Made_by: Vancouver KO Group | CGC_data_submission | |||
Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | ||
Species | Caenorhabditis elegans |