WormBase Tree Display for Strain: WBStrain00037920
expand all nodes | collapse all nodes | view schema
WBStrain00037920 | Status | Live | ||
---|---|---|---|---|
Genotype | syg-1(gk5167[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X. | |||
Public_name | VC4109 | |||
Contains | Gene | WBGene00003514 | ||
WBGene00004496 | ||||
WBGene00006365 | ||||
WBGene00006789 | ||||
Variation | WBVar02153640 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 15 Mar 2019 00:00:00 | |||
Location | CGC | |||
Remark | Homozygous viable. Deletion of 2190 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGATTTTAAGAATACTTTCTTTTCCATAT ; Right flanking sequence: CACGGTTTCTTGAGAGATTTCTGGTTTTGC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Inferred_automatically | From CGC strain data | |
Made_by: Vancouver KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |