WormBase Tree Display for Strain: WBStrain00037868
expand all nodes | collapse all nodes | view schema
| WBStrain00037868 | Status | Live | ||
|---|---|---|---|---|
| Genotype | Y18D10A.9(gk5013[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/hIn1[unc-101(sy241)] I . | |||
| Public_name | VC3986 | |||
| Contains | Gene | WBGene00003514 | ||
| WBGene00004496 | ||||
| WBGene00006789 | ||||
| WBGene00006829 | ||||
| Variation | WBVar00248948 | |||
| WBVar02149157 | ||||
| Rearrangement | hIn1 | |||
| Transgene | WBTransgene00026034 | |||
| Properties | Outcrossed | x0 | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 26 Jun 2018 00:00:00 | |||
| Location | CGC | |||
| Remark | Recessive lethal deletion balanced by hIn1. Deletion of 4986 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAAATTTCGGATTCGGGTTCCATGCCA; Right flanking sequence: GTCTGAAAATTGAAAATAAATTTAAAAACT. See WormBase Variation gk5013 for details. | Inferred_automatically | From CGC strain data | |
| Made_by: Vancouver KO Group | CGC_data_submission | |||
| Species | Caenorhabditis elegans |
