WormBase Tree Display for Strain: WBStrain00037851
expand all nodes | collapse all nodes | view schema
WBStrain00037851 | Status | Live | ||
---|---|---|---|---|
Genotype | ugt-9(gk5024[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V. | |||
Public_name | VC3950 | |||
Contains | Gene (4) | |||
Variation | WBVar02149164 | |||
Transgene | WBTransgene00026041 | |||
Properties | Outcrossed | x0 | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 26 Jun 2018 00:00:00 | |||
Location | CGC | |||
Remark | Homozygous viable. Deletion of 1266 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking sequence: AAGTTTTCGGAAGGCTTTCTGTAGGGTGAA; Right flanking sequence: GGAGGTGCTGTTGCGTACGACAAATTTGAT. See WormBase Variation gk5024 for details. | Inferred_automatically | From CGC strain data | |
Made_by: Vancouver KO Group | CGC_data_submission | |||
Species | Caenorhabditis elegans |