WormBase Tree Display for Strain: WBStrain00031056
expand all nodes | collapse all nodes | view schema
| WBStrain00031056 | Evidence | Paper_evidence | WBPaper00055300 | |
|---|---|---|---|---|
| Status | Live | |||
| Genotype | Y55F3BL.4(sy1174) IV. | |||
| Public_name | PS8012 | |||
| Contains | Gene | WBGene00185088 | ||
| Variation | WBVar02149252 | |||
| Properties | Outcrossed | xNo | ||
| Mutagen | CRISPR_Cas9 | |||
| CGC_received | 18 Feb 2021 00:00:00 | |||
| Location | CGC | |||
| Remark | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | |||
| Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of Y55F3BL.4; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GAAGACGACGGATTCACCCTGGTCACTGGTAGAAA Right flanking sequence: AGCCGGAAAACAGTCGGCGAAATTTgtcagttttcinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTGGTCACTGGTAGAAAAGCMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 | Inferred_automatically | From CGC strain data | ||
| Made_by: Heenam Park | CGC_data_submission | |||
| Reference | WBPaper00055300 | |||
| Species | Caenorhabditis elegans |
