WormBase Tree Display for Strain: WBStrain00031028
expand all nodes | collapse all nodes | view schema
WBStrain00031028 | Evidence | Paper_evidence | WBPaper00055300 | |
---|---|---|---|---|
Status | Live | |||
Genotype | C01B10.10(sy1114) IV. | |||
Public_name | PS7858 | |||
Contains | Gene | WBGene00015284 | ||
Variation | WBVar02149228 | |||
Properties | Outcrossed | xNo | ||
Mutagen | CRISPR_Cas9 | |||
CGC_received | 18 Feb 2021 00:00:00 | |||
Location | CGC | |||
Remark | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | |||
Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of C01B10.10; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: catcatcagAATATGGACCCGCGTGTATGTCCAATTRight flanking sequence: CAACATGGACCCAGAGCCCTCAAAAATGGGTCGATGinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GCTCTGGGTCCATGTTGAATMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616 | Inferred_automatically | From CGC strain data | ||
Made_by: Heenam Park | CGC_data_submission | |||
Reference | WBPaper00055300 | |||
Species | Caenorhabditis elegans |