WormBase Tree Display for Strain: WBStrain00030609
expand all nodes | collapse all nodes | view schema
| WBStrain00030609 | Status | Live | ||
|---|---|---|---|---|
| Genotype | smg-1(cc546) I. | |||
| Public_name | PD8120 | |||
| Contains | Gene | WBGene00004879 | ||
| Variation | WBVar00051557 | |||
| Properties | Outcrossed | x2 | ||
| Mutagen | EMS | |||
| CGC_received | 23 Apr 1997 00:00:00 | |||
| Location | CGC | |||
| Remark | Made_by: Getz and Fire | CGC_data_submission | ||
| Reference WBPaper00058995 added based on published strain data identified by Textpresso literature search. | ||||
| WBStrain mapped, WBPaper00059578 added based on AFP_Strain data. | Curator_confirmed | WBPerson1983 | ||
| Temperature sensitive. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] | Inferred_automatically | From CGC strain data | ||
| Reference | WBPaper00058995 | |||
| WBPaper00059578 | ||||
| Species | Caenorhabditis elegans |
