WormBase Tree Display for Sequence: Y5F2A

Y5F2A DNA: Y5F2A 18397
  SMap: S_child (11)
  Structure: From: Source: CHROMOSOME_IV
    Overlap_right: M7 18293
    Overlap_left: F36H1
    Clone_left_end: M7 18293
      Y5F2A 1
    Clone_right_end: F36H1 100
      Y5F2A 18397
  DB_info: Database: EMBL NDB_AC AL032641
        NDB_SV AL032641.1
    Secondary_accession: Z98871
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: Lennard N
    From_laboratory: HX
    Date_directory: 980630
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: Y5F2A
  Properties: Genomic_canonical
    Checksum: MD5: af08be91602d3d757fdc1a5b1e0a6812
    Status: Finished: 30 Jun 1998 00:00:00
      Submitted: 29 Oct 1998 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-IV Ends: Left: 5663
        Right: 5697
  Interpolated_map_position: IV 4.82439
  Assembly_tags: Clone right end 100 97 F36H1
    Clone left end 18293 18296 M7
    Finished Left 1 4 Y5F2A
    annotation 9244 10690 First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[ ] Single clone region[X] Forced join[ ] OtherAdd a comment here -Tandem repeat, exact length unknown.Approximately 1.4Kb of AGACTACCT motif assembled in with some base differences and 1 forced join.
      10691 14239 First select a Feature -[ ] Unsure[X] Misc_featureThen select the text for the note(s) -[X] Tandem repeat[X] Single clone region[X] Forced join[ ] OtherAdd a comment here -Tandem repeat, exact length unknown.Approximately 3.5Kb of TTATGGAAAAGTGGCTCTAGAGCCACTAGAAATACCAGT motif assembled in with some base differences, 2 forced joins and 1 single clone area.
    Finished Right 18397 18394 Y5F2A
  Method: Genomic_canonical