WormBase Tree Display for Sequence: K08E3
expand all nodes | collapse all nodes | view schema
K08E3 | DNA | K08E3 | 39565 | ||
---|---|---|---|---|---|
SMap | S_child (12) | ||||
Structure | From | Source | CHROMOSOME_III | ||
Overlap_right | 3R5 | 39514 | |||
Overlap_left | W06F12 | ||||
Clone_left_end | K08E3 | 1 | |||
Clone_right_end | W06F12 | 467 | |||
K08E3 | 39565 | ||||
DB_info | Database | EMBL | NDB_AC | Z81568 | |
NDB_SV | Z81568.1 | ||||
Keyword | HTG | ||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
Origin (5) | |||||
Visible | Clone | K08E3 | |||
Remark | Transposon K08E3.9 converted into an S_Child [020208 kj] | ||||
Properties | Genomic_canonical | ||||
Checksum | MD5 | 1a8bf674fb68a7a0a74f1f61f9536ddb | |||
Status | Finished | 08 Jul 1998 00:00:00 | |||
Submitted | 06 Nov 1996 00:00:00 | ||||
Annotated | 01 Jan 1980 00:00:00 | ||||
Map | Sequence-III | Ends (2) | |||
Interpolated_map_position | III | 21.4948 | |||
Assembly_tags | cosmid vector | 4 | 1 | CAF:END=Left::loristB | |
1 | 4 | CAF:END=Left::loristB | |||
39565 | 39562 | CAF:END=Right::loristB | |||
39562 | 39565 | CAF:END=Right::loristB | |||
Finished Left | 1 | 4 | K08E3 | ||
Clone left end | 1 | 4 | K08E3 | ||
Clone right end | 464 | 467 | W06F12 | ||
39562 | 39565 | K08E3 | |||
Finished Right | 39562 | 39565 | K08E3 | ||
annotation | 39318 | 39412 | First select a Feature -[ ] Unsure[x] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -single pUC18 clone in inverted repeatregion. Size of the region is confirmedby restriction digest | ||
9523 | 10344 | tandem repeat region with typical repeat element GAGACTTTCGTGGTGAGACCTTTGTGGT (a 28-mer). Restriction digest shows that 130 bases of repeat region are missing from this assembly. | |||
repeat | 8218 | 9517 | |||
12290 | 13059 | ||||
13071 | 14139 | ||||
Inverted Repeat | 35448 | 34676 | |||
35519 | 36312 | ||||
38896 | 38790 | ||||
39374 | 39480 | ||||
Method | Genomic_canonical |