WormBase Tree Display for Sequence: H20J18
expand all nodes | collapse all nodes | view schema
H20J18 | DNA | H20J18 | 8905 | |||
---|---|---|---|---|---|---|
SMap | S_child | Gene_child | WBGene00219990 | 8586 | 8528 | |
CDS_child (126) | ||||||
Transcript | H20J18.2 | 8586 | 8528 | |||
Nongenomic | yk292g7 | 97 | 3690 | |||
PCR_product | cenix:53-g12 | 2814 | 3326 | |||
mv_H20J18.1 | 282 | 4876 | ||||
sjj_H20J18.1 | 2541 | 3693 | ||||
Allele (151) | ||||||
Oligo_set | Aff_F45E6.5 | 102 | 43 | |||
Aff_H20J18.1 | 1857 | 280 | ||||
Feature_object (128) | ||||||
Feature_data | H20J18:Polysome | 1 | 8905 | |||
H20J18:TranscriptionallyActiveRegion | 1 | 8905 | ||||
H20J18:ChIPSeqTF | 1 | 8905 | ||||
H20J18:TRF | 1 | 8905 | ||||
H20J18:Dust | 1 | 8905 | ||||
Homol_data (11) | ||||||
Structure | From | Source | CHROMOSOME_X | |||
Overlap_right | C16D6 | 8802 | ||||
Overlap_left | F45E6 | |||||
Clone_left_end | C16D6 | 8802 | ||||
Clone_right_end | F45E6 | 104 | ||||
DB_info | Database | EMBL | NDB_AC | AL023493 | ||
NDB_SV | AL023493.1 | |||||
Keyword | HTG | |||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
Origin | From_author | Steward CA | ||||
From_laboratory | HX | |||||
Date_directory | 980713 | |||||
Species | Caenorhabditis elegans | |||||
Strain | WBStrain00000001 | |||||
Visible | Clone | H20J18 | ||||
Properties | Genomic_canonical | |||||
Checksum | MD5 | 17c1efd2b04c4db06e5d487ed8eb0238 | ||||
Status | Finished | 13 Jul 1998 00:00:00 | ||||
Submitted | 08 May 1998 00:00:00 | |||||
Annotated | 01 Jan 1980 00:00:00 | |||||
Map | Sequence-X | Ends | Left | 6750 | ||
Right | 6770 | |||||
Interpolated_map_position | X | 7.13287 | ||||
Assembly_tags | Finished Left | 4 | 1 | H20J18 | ||
Clone right end | 104 | 101 | F45E6 | |||
oligo | 238 | 255 | serial#=H20J18.4 template=sz59f6 sequence=CATACATTGGACAGTCAG flags= | |||
513 | 494 | serial#=H20J18.2 template=sz93b11 sequence=GAATTTCAAACAAGCCATAC flags= | ||||
3738 | 3755 | serial#=H20J18.3 template= sequence=TTGCGTTCACAAATTGAG flags= | ||||
4098 | 4082 | serial#=H20J18.1 template= sequence=CAACATCTGCAAGCAGC flags= | ||||
6941 | 6958 | serial#=H20J18.5 template= sequence=TTTTTATGGCACTGTTGG flags= | ||||
cosmid vector | 3994 | 4002 | ||||
Clone left end | 8805 | 8802 | C16D6 | |||
DSTM | 428 | 333 | ||||
1395 | 1308 | |||||
1780 | 1780 | |||||
3492 | 3789 | |||||
4180 | 4046 | |||||
5532 | 5285 | |||||
8801 | 8691 | |||||
annotation | 3852 | 3993 | First select a Feature - [ ] Unsure [X] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [X] Single clone region [ ] Forced join [ ] Other Add a comment here - | |||
Finished Right | 8905 | 8902 | H20J18 | |||
Method | Genomic_canonical |