WormBase Tree Display for Sequence: F48C5
expand all nodes | collapse all nodes | view schema
| F48C5 | DNA | F48C5 | 19723 | |||
|---|---|---|---|---|---|---|
| SMap | S_child | Gene_child | WBGene00201632 | 7354 | 7498 | |
| WBGene00195614 | 9626 | 9555 | ||||
| WBGene00196383 | 9555 | 9626 | ||||
| WBGene00195818 | 7700 | 7560 | ||||
| WBGene00197327 | 7627 | 7772 | ||||
| WBGene00195418 | 7500 | 7356 | ||||
| WBGene00009842 | 5900 | 3615 | ||||
| WBGene00009843 | 13596 | 10881 | ||||
| CDS_child (84) | ||||||
| Transcript | F48C5.3 | 7500 | 7356 | |||
| F48C5.4 | 9626 | 9555 | ||||
| F48C5.5 | 7700 | 7560 | ||||
| F48C5.6 | 9555 | 9626 | ||||
| F48C5.7 | 7627 | 7772 | ||||
| F48C5.8 | 7354 | 7498 | ||||
| F48C5.1.1 | 5900 | 3615 | ||||
| F48C5.2.1 | 13460 | 10882 | ||||
| F48C5.2.2 | 13596 | 10881 | ||||
| Nongenomic | yk270g3 | 3689 | 5391 | |||
| PCR_product | cenix:87-b9 | 3755 | 5448 | |||
| mv_F48C5.1 | 3913 | 5884 | ||||
| p_F48C5.1_93 | 5886 | 7885 | ||||
| sjj_F48C5.1 | 3915 | 5821 | ||||
| Allele (216) | ||||||
| Oligo_set | Aff_F48C5.1 | 5506 | 3911 | |||
| Feature_object (105) | ||||||
| Feature_data | F48C5:Polysome | 1 | 19723 | |||
| F48C5:TranscriptionallyActiveRegion | 1 | 19723 | ||||
| F48C5:ChIPSeqTF | 1 | 19723 | ||||
| F48C5:TRF | 1 | 19723 | ||||
| F48C5:Dust | 1 | 19723 | ||||
| F48C5:inverted | 1 | 19723 | ||||
| Homol_data (15) | ||||||
| Structure | From | Source | CHROMOSOME_X | |||
| Overlap_right | T25C12 | 19619 | ||||
| Overlap_left | F46C3 | |||||
| Clone_left_end | F48C5 | 1 | ||||
| T25C12 | 19619 | |||||
| Clone_right_end | F46C3 | 9359 | ||||
| DB_info | Database | EMBL | NDB_AC | Z68107 | ||
| NDB_SV | Z68107.2 | |||||
| DB_remark | The region 318..3064 contains tandemly repetitive sequences. Restriction digest data from cosmid DNA suggests that 5KB of sequence is missing. Because of the repetitive nature of this region base accurracy cannot be guaranteed. The size of this region has not be predicted using non-cloned genomic DNA. | |||||
| [991027 dl] : removed ambiquous bases | ||||||
| Keyword | HTG | |||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
| Origin | From_author | Harris BR | ||||
| From_laboratory | HX | |||||
| Date_directory | 991022 | |||||
| Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000001 | |||||
| Visible | Clone | F48C5 | ||||
| Properties | Genomic_canonical | |||||
| Checksum | MD5 | 435cacb3d34c2d1e45619ab0c13f09a1 | ||||
| Status | Finished | 31 Oct 1995 00:00:00 | ||||
| Submitted | 23 Nov 1995 00:00:00 | |||||
| Annotated | 22 Nov 1995 00:00:00 | |||||
| Map | Sequence-X | Ends | Left | 6228 | ||
| Right | 6245 | |||||
| Interpolated_map_position | X | 3.75862 | ||||
| Assembly_tags | Clone left end | 1 | 4 | F48C5 | ||
| 19619 | 19622 | T25C12 | ||||
| Finished Left | 1 | 4 | F48C5 | |||
| Clone right end | 9359 | 9356 | F46C3 | |||
| Finished Right | 19723 | 19719 | F48C5 | |||
| annotation | 318 | 3044 | Tandemly repetitive sequences.Restriction data from cosmid DNA suggests approximately 5kb are missing from this region.The HaeIII restriction fragment size from cosmid DNA corresponding to this region is approximately 7900 bp.Because of the repetitive nature of this sequence, base accuracy cannot be guaranteed in this region. The size of this region has not been predicted using non-clonedgenomic DNA. | |||
| Multiple copies of a 25-26mer which are variations of CCGTAATGCCTAACTTTAGAATCTG | ||||||
| 330 | ||||||
| 330 | 318 | |||||
| 2065 | 3061 | Multiple copies of a 25-26mer which are variations of CATTGCGGCGGATTTTAGAAAAATG | ||||
| Method | Genomic_canonical |
