WormBase Tree Display for Sequence: F45H10
expand all nodes | collapse all nodes | view schema
| F45H10 | DNA | F45H10 | 19104 | |||
|---|---|---|---|---|---|---|
| SMap | S_child | Gene_child | WBGene00009741 | 11243 | 10389 | |
| WBGene00000113 | 7129 | 2586 | ||||
| WBGene00009739 | 8391 | 7231 | ||||
| WBGene00009740 | 9943 | 8524 | ||||
| CDS_child (180) | ||||||
| Transcript | F45H10.1a.1 | 7129 | 2586 | |||
| F45H10.1b.1 | 3515 | 2600 | ||||
| F45H10.2.1 | 8391 | 7231 | ||||
| F45H10.2.2 | 8391 | 7234 | ||||
| F45H10.3.1 | 9943 | 8524 | ||||
| F45H10.4.1 | 11243 | 10389 | ||||
| F45H10.5.5 | 17218 | 19067 | ||||
| PCR_product (14) | ||||||
| Allele (698) | ||||||
| Oligo_set | Aff_F45H10.1 | 3219 | 2538 | |||
| Aff_F45H10.2 | 8385 | 7327 | ||||
| Aff_F45H10.3 | 9936 | 8594 | ||||
| Aff_F45H10.4 | 11135 | 10459 | ||||
| Feature_object (227) | ||||||
| Feature_data | F45H10:Polysome | 1 | 19104 | |||
| F45H10:TranscriptionallyActiveRegion | 1 | 19104 | ||||
| F45H10:ChIPSeqTF | 1 | 19104 | ||||
| F45H10:TRF | 1 | 19104 | ||||
| F45H10:Dust | 1 | 19104 | ||||
| F45H10:inverted | 1 | 19104 | ||||
| Homol_data (20) | ||||||
| Structure | From | Source | CHROMOSOME_II | |||
| Overlap_right | F54F11 | 18990 | ||||
| Overlap_left | E01G4 | |||||
| Clone_right_end | E01G4 | 104 | ||||
| F45H10 | 19104 | |||||
| DB_info | Database | EMBL | NDB_AC | Z81538 | ||
| NDB_SV | Z81538.2 | |||||
| DB_remark | [121025] Sequence correction: SNP 0 bases @ 824 | |||||
| Keyword | HTG | |||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
| Origin | From_author | Sims MA | ||||
| From_laboratory | HX | |||||
| Date_directory | 970407 | |||||
| Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000001 | |||||
| Visible | Clone | F45H10 | ||||
| Properties | Genomic_canonical | |||||
| Checksum | MD5 | 88f0bebff8650b0c1dfa121951eeb253 | ||||
| Status | Finished | 07 Apr 1997 00:00:00 | ||||
| Submitted | 06 Nov 1996 00:00:00 | |||||
| Annotated | 16 Apr 1997 00:00:00 | |||||
| Map | Sequence-II | Ends | Left | 7798 | ||
| Right | 7816 | |||||
| Interpolated_map_position | II | 17.6535 | ||||
| Assembly_tags | Finished Left | 1 | 4 | F45H10 | ||
| Clone right end | 104 | 101 | Right hand end of E01G4. | |||
| 19104 | 19101 | Right hand end of F45H10. | ||||
| oligo | 6411 | 6433 | serial#=F45H10.6 sequence=CTAAAATTTCCCAAATTTTCCAG flags= | |||
| 8569 | 8552 | serial#=F45H10.3 sequence=TTAGTGGTTCAGAATGTG flags= | ||||
| annotation | 2336 | 2313 | These 24 bases are in the middle of an inverted repeat. They are not double stranded as terminators would not sequence across the repeat. | |||
| Finished Right | 19101 | 19104 | F45H10 | |||
| Method | Genomic_canonical |
