WormBase Tree Display for Sequence: F28H6
expand all nodes | collapse all nodes | view schema
| F28H6 | DNA | F28H6 | 37975 | |||
|---|---|---|---|---|---|---|
| SMap | S_child | Gene_child (14) | ||||
| CDS_child (213) | ||||||
| Transcript (15) | ||||||
| Nongenomic | yk285e10 | 17199 | 21011 | |||
| PCR_product (18) | ||||||
| Allele (884) | ||||||
| Oligo_set | Aff_F28H6.2 | 30955 | 31807 | |||
| Aff_F28H6.3 | 26332 | 25682 | ||||
| Aff_F28H6.4 | 19315 | 20896 | ||||
| Aff_F28H6.5 | 15806 | 16900 | ||||
| Aff_F28H6.6 | 5996 | 5168 | ||||
| Aff_F28H6.7 | 3693 | 4333 | ||||
| Feature_object (257) | ||||||
| Feature_data | F28H6:Polysome | 1 | 37975 | |||
| F28H6:TranscriptionallyActiveRegion | 1 | 37975 | ||||
| F28H6:ChIPSeqTF | 1 | 37975 | ||||
| F28H6:TRF | 1 | 37975 | ||||
| F28H6:Dust | 1 | 37975 | ||||
| F28H6:inverted | 1 | 37975 | ||||
| Homol_data (19) | ||||||
| Structure | From | Source | CHROMOSOME_X | |||
| Overlap_right | R03E1 | 37873 | ||||
| Overlap_left | F16B12 | |||||
| Clone_left_end | F28H6 | 1 | ||||
| R03E1 | 37873 | |||||
| Clone_right_end | F16B12 | 19043 | ||||
| F28H6 | 37975 | |||||
| DB_info | Database | EMBL | NDB_AC | AL031621 | ||
| NDB_SV | AL031621.2 | |||||
| DB_remark | [121025] Sequence correction: SNP 0 bases @ 6595 | |||||
| Keyword | HTG | |||||
| EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | ||||
| Origin | From_author | McMurray AA | ||||
| From_laboratory | HX | |||||
| Date_directory | 980511 | |||||
| Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00000001 | |||||
| Visible | Clone | F28H6 | ||||
| Properties | Genomic_canonical | |||||
| Checksum | MD5 | c0ca9608203a09fbfbae8e59268bc4d5 | ||||
| Status | Finished | 11 May 1998 00:00:00 | ||||
| Submitted | 21 Sep 1998 00:00:00 | |||||
| Annotated | 01 Jan 1980 00:00:00 | |||||
| Map | Sequence-X | Ends | Left | 7633 | ||
| Right | 7654 | |||||
| Interpolated_map_position | X | 16.5105 | ||||
| Assembly_tags | Clone left end | 1 | 4 | F28h6 | ||
| 19652 | 19655 | R03E1 | ||||
| Finished Left | 1 | 4 | F28H6 | |||
| Clone right end | 19040 | 19043 | F16B12 | |||
| 37972 | 37975 | F28H6 | ||||
| annotation | 23687 | 23692 | First select a Feature - [x] Unsure [ ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ ] Single clone region [ ] Forced join [ x] Other Add a comment here - one clone has 6 A's, the other 2 have 5 A's - edited to 6 A's | |||
| 7005 | 9879 | Tandem repeat region, bases 7000-8650.Typical repeat element GGCGGGAATTCAAATTTTAATTTTTTGAAAATATTTT (36-mer) acrossbases 7000-8650.Typical repeat element GAGACCTTTCGTGGT(15-mer) across bases 8710-9850.Restriction digest shows that 200 bases are missing from the repeat region,probably from the 36-mer section. | ||||
| 9351 | 9745 | At least 78 copies of a 15bp rpt: CgTGG | ||||
| 9964 | 9921 | one copy of 45mer | ||||
| 13861 | 14019 | x copies of 6bp repeat, perfectly conserved TAGGCA | ||||
| 22875 | 23756 | First select a Feature - [ ] Unsure [x ] Misc_feature Then select the text for the note(s) - [ ] Tandem repeat [ x] Single clone region [ ] Forced join [ ] Other Add a comment here - small insert library reads to join inverted repeat region | ||||
| 24295 | 24316 | First select a Feature -[ ] Unsure[x ] Misc_featureThen select the text for the note(s) -[ ] Tandem repeat[ x] Single clone region[ ] Forced join[ ] OtherAdd a comment here -single read from small insert libraryto join inverted repeat region | ||||
| Finished Right | 37972 | 37975 | F28H6 | |||
| Method | Genomic_canonical |
