WormBase Tree Display for Sequence: F22D6
expand all nodes | collapse all nodes | view schema
F22D6 | DNA | F22D6 | 41494 | ||
---|---|---|---|---|---|
SMap | S_child (11) | ||||
Structure (5) | |||||
DB_info | Database | EMBL | NDB_AC | Z71262 | |
NDB_SV | Z71262.1 | ||||
Keyword | HTG | ||||
EMBL_dump_info | EMBL_dump_method | worm_EMBL-dump | |||
Origin | From_author | Wilkinson J | |||
From_laboratory | HX | ||||
Date_directory | 960326 | ||||
Species | Caenorhabditis elegans | ||||
Strain | WBStrain00000001 | ||||
Visible | Clone | F22D6 | |||
Properties | Genomic_canonical | ||||
Checksum | MD5 | 1d0c8659db6a21a73b17ea47c654b7ea | |||
Status | Finished | 26 Mar 1996 00:00:00 | |||
Submitted | 19 Apr 1996 00:00:00 | ||||
Annotated | 18 Apr 1996 00:00:00 | ||||
Map | Sequence-I | Ends | Left | 3274 | |
Right | 3298 | ||||
Interpolated_map_position | I | 1.73029 | |||
Assembly_tags | Finished Left | 1 | 4 | F22D6 | |
Clone left end | 1 | 4 | Clone left end F22D6 | ||
Clone right end | 11258 | 11265 | End of W01A8 | ||
41491 | 41494 | END OF F22D6 | |||
oligo | 14557 | 14576 | serial#=F22D6.1 template=xx96e2.s1 sequence=CTAACTCGTTCTATTTTAGC flags= | ||
17579 | 17597 | serial#=F22D6.7 template=xx95a4.s1tc sequence=GATCAATCTGATTATCGTC flags= | |||
20661 | 20681 | serial#=F22D6.4 template=xx98c8.s1 sequence=CAATCTTCGTTCTTTACTAAG flags= | |||
24395 | 24416 | serial#=F22D6.3 template=xx99b1.s1 sequence=CATTAATATCGACGATAGTAAG flags= | |||
25009 | 25027 | serial#=F22D6.6 template=xx95c7.s1 sequence=GCGAAAAACTAACATTAGC flags= | |||
25843 | 25859 | serial#=F22D7.2 template=xx94c12.s1t sequence=CATAACCATCTTCAGGC flags= | |||
26218 | 26235 | serial#=F22D6.8 template=xx96g8.s2a sequence=ATGGAATTAGGAAGTACG flags= | |||
40765 | 40782 | serial#=F22D6.5 template=xx97g2.s1 sequence=AAATGAATCTCCACTTCC flags= | |||
Finished Right | 41491 | 41494 | F22D6 | ||
Method | Genomic_canonical |