WormBase Tree Display for Sequence: C47A4

C47A4 DNA: C47A4 40664
  SMap: S_child (11)
  Structure: From: Source: CHROMOSOME_IV
    Overlap_right: F56F12 40564
    Overlap_left: F52D4
    Clone_left_end: F52D4 101
      F56F12 9816
    Clone_right_end: C47A4 40664
  DB_info: Database: EMBL NDB_AC Z82263
        NDB_SV Z82263.1
    DB_remark: [981006 dl] : Cosmid flipped
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: Mortimore BJ
    From_laboratory: HX
    Date_directory: 981002
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: C47A4
  Properties: Genomic_canonical
    Checksum: MD5: df9fab8e8a0e04088b64cef8b81adf6b
    Status: Finished: 02 Oct 1998 00:00:00
      Submitted: 11 Nov 1996 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-IV Ends: Left: 7107
        Right: 7130
  Interpolated_map_position: IV 10.6879
  Assembly_tags: Finished Left 1 4 C47A4
    Clone left end 104 101 F52D4
      9816 9819 F56F12
    Clone right end 40664 40661 C47A4
    Finished Right 40664 40661 C47A4
    annotation 24526 21819 First select a Feature -[ ] Unsure[*] Misc_featureThen select the text for the note(s) -[*] Tandem repeat[ ] Single clone region[ ] Forced join[ ] OtherAdd a comment here - 30 copies of 93 base tandem repeat, typical unit : TAGGCTTGAGTGAATAACAACCTGCTTGGAATAGGATTATAGCCAGCCCAGTTTCCAAGACTATTCGGGCCTGCGGCCCTCAAACTTGGTTGA. Restriction digest indicates that approximately 8 copies are missing from this region.
  Method: Genomic_canonical