WormBase Tree Display for RNAi: WBRNAi00114226
expand all nodes | collapse all nodes | view schema
| WBRNAi00114226 | Homol | Homol_homol | F38A6:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | caagctcgacggttgctgcatcgccagccgataggtcttattctggtgtaagcggagggcaaggccaagaactcacgattcaggaatttgaaactgtcacggaaaagatcagaagacatggaacttatggacaatcgaaacctccatactcttacattagcttaattactatggcaattcaaaagtctaattctagacaattgacattgtctgaaatctacaattggatcatggatttgttcccttactatcagaacaatcaacaaagatggcaaaactcaattcgccactccctctccttcaatgattgctttgtaaaggttgccaggtaagagtcttgaaaattaaagttttttctggacacgttttgtcccgataaaaaacttcttattgttttcccacaaaaaccatcatttcctattataatcggaacctatatagtttatctcaaggactaccttttctgcagcgccacatttattataccgtgcgcccaagggacacccattgatgcgtgaagctgttgaaatgagaaattaccggagagagtgagggtgcgcgttagtgaaaagatttgacaaaaaatctatatggatgttttccggaaacgatttacaaagactaagtttataattttcaggtcccctgacaagcctggaaagggatccttctggactcttcacgagcactgtgggaatatgtttgagaatggatgctacctccgtaggcagaagagattcaaggtcaaggaacgtgagccatcgagaaagaagagaaatgccaactcccaacaattgcatcaacaacaacacattccaaaaatggaaatcaaagaagaggatccaacatccatcacgaccacatcatcacttggtgcttattctctgatccctcaaatttctacaaagaaggagatcaaggaagagctgaaagctgtgcaagatgcaactgcagctgctgccaatcttggcctaattgacccatcgggaacgccgtcggctgttaatcacagtcaacctacttcagt | |||
| Experiment | Strain | WBStrain00047119 | |||
| Treatment | Embryonic lethality was scored by imaging a well of 50-100 embryos at 10x magnification. When 20% or more of the embryos exhibited embryonic lethality, the RNAi was scored as embryonic lethal. All other phenotypes scored at 60x magnification during the first 10 hours of embryonic development. | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F38A6.1a | Inferred_automatically | RNAi_primary | |
| F38A6.1c | Inferred_automatically | RNAi_primary | |||
| F38A6.1b | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004013 | Inferred_automatically | RNAi_primary | ||
| Transcript | F38A6.1c.1 | Inferred_automatically | RNAi_primary | ||
| F38A6.1b.1 | Inferred_automatically | RNAi_primary | |||
| F38A6.1a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00056424 | ||||
| Phenotype | WBPhenotype:0000050 | Remark | 1.5-3-Fold arrest, epidermal defects | ||
| WBPhenotype:0000361 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| WBPhenotype:0000366 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| WBPhenotype:0000368 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| WBPhenotype:0000494 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| WBPhenotype:0000816 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| WBPhenotype:0002176 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| WBPhenotype:0002569 | Remark | 1.5-3-Fold arrest, epidermal defects | |||
| Remark | (Table S2) pha-4 RNAi | ||||
| Method | RNAi |
